Incidental Mutation 'R4323:Akr1b3'
ID323909
Institutional Source Beutler Lab
Gene Symbol Akr1b3
Ensembl Gene ENSMUSG00000001642
Gene Namealdo-keto reductase family 1, member B3 (aldose reductase)
SynonymsAhr-1, Aldor1, Ahr1, ALR2, Aldr1, AR
MMRRC Submission 041094-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R4323 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location34302434-34317478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34310927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 166 (T166A)
Ref Sequence ENSEMBL: ENSMUSP00000114391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
Predicted Effect probably benign
Transcript: ENSMUST00000102980
AA Change: T143A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: T143A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
AA Change: T166A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642
AA Change: T166A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,547,311 Y414C probably damaging Het
Ankhd1 C T 18: 36,578,633 S94L probably damaging Het
B4galt3 G T 1: 171,275,942 M68I possibly damaging Het
Bpnt1 A C 1: 185,356,589 H312P probably benign Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Clasp2 T C 9: 113,889,959 V724A possibly damaging Het
Copa G T 1: 172,119,264 C1022F probably damaging Het
Cwf19l2 T G 9: 3,430,452 F261L probably damaging Het
Esr1 G A 10: 5,001,307 V562M possibly damaging Het
Fap T C 2: 62,503,372 H643R probably damaging Het
Fbxo38 T A 18: 62,515,161 M769L probably benign Het
Fgfr1 A G 8: 25,573,899 N814S probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Itsn1 G A 16: 91,818,552 probably benign Het
Jam2 T C 16: 84,822,856 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Med23 T C 10: 24,870,705 I14T probably benign Het
Mitf A G 6: 97,991,949 Y10C probably benign Het
Mpo T C 11: 87,796,039 S165P probably damaging Het
Neb T G 2: 52,264,110 M2330L possibly damaging Het
Nup214 T C 2: 31,994,684 S486P probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Parp6 G A 9: 59,630,686 V205I possibly damaging Het
Pate2 A T 9: 35,670,471 probably benign Het
Pdss1 T C 2: 22,912,596 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slitrk3 A G 3: 73,050,785 L218P probably damaging Het
Sltm T C 9: 70,580,247 I521T probably benign Het
Smchd1 A G 17: 71,428,275 I618T probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Sp8 A G 12: 118,848,436 I9V probably benign Het
Usp9y T A Y: 1,434,407 M352L possibly damaging Het
Vmn1r46 T C 6: 89,976,367 M66T probably benign Het
Vmn2r111 A T 17: 22,573,178 N32K probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Vps13d T A 4: 145,152,778 T1486S probably benign Het
Wdr55 A G 18: 36,763,100 N281S probably benign Het
Zswim6 G A 13: 107,889,403 noncoding transcript Het
Other mutations in Akr1b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b3 APN 6 34304319 missense probably damaging 1.00
R0567:Akr1b3 UTSW 6 34304345 splice site probably null
R0611:Akr1b3 UTSW 6 34309642 missense probably benign 0.02
R1564:Akr1b3 UTSW 6 34306535 splice site probably null
R2445:Akr1b3 UTSW 6 34310934 missense probably benign 0.26
R2507:Akr1b3 UTSW 6 34310064 missense probably damaging 1.00
R4373:Akr1b3 UTSW 6 34304267 utr 3 prime probably benign
R4606:Akr1b3 UTSW 6 34306664 unclassified probably benign
R5513:Akr1b3 UTSW 6 34316646 intron probably benign
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6031:Akr1b3 UTSW 6 34312674 missense probably benign 0.07
R6560:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6561:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6632:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6654:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6655:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6657:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6658:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R6662:Akr1b3 UTSW 6 34310004 missense possibly damaging 0.56
R8209:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
R8226:Akr1b3 UTSW 6 34311932 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGATGTGCCCTCCCATC -3'
(R):5'- CATCTTGGCTACCACATATGCC -3'

Sequencing Primer
(F):5'- GATGTGCCCTCCCATCCACAG -3'
(R):5'- GGCTACCACATATGCCTCTTC -3'
Posted On2015-06-24