Incidental Mutation 'R4323:Vmn1r46'
ID323911
Institutional Source Beutler Lab
Gene Symbol Vmn1r46
Ensembl Gene ENSMUSG00000061653
Gene Namevomeronasal 1 receptor 46
SynonymsV1rb8
MMRRC Submission 041094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4323 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location89969313-89986721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89976367 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 66 (M66T)
Ref Sequence ENSEMBL: ENSMUSP00000154175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075797] [ENSMUST00000205088] [ENSMUST00000226715] [ENSMUST00000228231] [ENSMUST00000228349] [ENSMUST00000228401]
Predicted Effect probably benign
Transcript: ENSMUST00000075797
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075197
Gene: ENSMUSG00000061653
AA Change: M66T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 301 5.9e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205088
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144888
Gene: ENSMUSG00000061653
AA Change: M66T

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 301 5.9e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226715
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000228231
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000228349
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000228401
AA Change: M66T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,547,311 Y414C probably damaging Het
Akr1b3 T C 6: 34,310,927 T166A probably benign Het
Ankhd1 C T 18: 36,578,633 S94L probably damaging Het
B4galt3 G T 1: 171,275,942 M68I possibly damaging Het
Bpnt1 A C 1: 185,356,589 H312P probably benign Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Clasp2 T C 9: 113,889,959 V724A possibly damaging Het
Copa G T 1: 172,119,264 C1022F probably damaging Het
Cwf19l2 T G 9: 3,430,452 F261L probably damaging Het
Esr1 G A 10: 5,001,307 V562M possibly damaging Het
Fap T C 2: 62,503,372 H643R probably damaging Het
Fbxo38 T A 18: 62,515,161 M769L probably benign Het
Fgfr1 A G 8: 25,573,899 N814S probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Itsn1 G A 16: 91,818,552 probably benign Het
Jam2 T C 16: 84,822,856 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Med23 T C 10: 24,870,705 I14T probably benign Het
Mitf A G 6: 97,991,949 Y10C probably benign Het
Mpo T C 11: 87,796,039 S165P probably damaging Het
Neb T G 2: 52,264,110 M2330L possibly damaging Het
Nup214 T C 2: 31,994,684 S486P probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Parp6 G A 9: 59,630,686 V205I possibly damaging Het
Pate2 A T 9: 35,670,471 probably benign Het
Pdss1 T C 2: 22,912,596 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slitrk3 A G 3: 73,050,785 L218P probably damaging Het
Sltm T C 9: 70,580,247 I521T probably benign Het
Smchd1 A G 17: 71,428,275 I618T probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Sp8 A G 12: 118,848,436 I9V probably benign Het
Usp9y T A Y: 1,434,407 M352L possibly damaging Het
Vmn2r111 A T 17: 22,573,178 N32K probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Vps13d T A 4: 145,152,778 T1486S probably benign Het
Wdr55 A G 18: 36,763,100 N281S probably benign Het
Zswim6 G A 13: 107,889,403 noncoding transcript Het
Other mutations in Vmn1r46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Vmn1r46 APN 6 89976904 missense probably damaging 1.00
IGL02488:Vmn1r46 APN 6 89976981 missense probably benign 0.10
IGL03116:Vmn1r46 APN 6 89976916 missense probably benign 0.16
IGL03270:Vmn1r46 APN 6 89976774 missense probably damaging 1.00
R0109:Vmn1r46 UTSW 6 89977062 missense probably benign 0.03
R0126:Vmn1r46 UTSW 6 89976953 missense probably benign
R0681:Vmn1r46 UTSW 6 89976964 missense probably damaging 1.00
R1501:Vmn1r46 UTSW 6 89976216 missense probably benign 0.03
R1717:Vmn1r46 UTSW 6 89976829 missense probably damaging 1.00
R1937:Vmn1r46 UTSW 6 89976734 missense probably benign 0.00
R5449:Vmn1r46 UTSW 6 89976361 missense probably benign 0.18
R6062:Vmn1r46 UTSW 6 89976259 missense possibly damaging 0.64
R6385:Vmn1r46 UTSW 6 89976445 missense probably damaging 0.99
R6431:Vmn1r46 UTSW 6 89976407 missense probably benign 0.13
R7126:Vmn1r46 UTSW 6 89976994 missense possibly damaging 0.79
R7391:Vmn1r46 UTSW 6 89976625 missense probably benign 0.23
Z1088:Vmn1r46 UTSW 6 89976741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCCTACCCACATACAATG -3'
(R):5'- AAGGCACCTGAGATGTGATG -3'

Sequencing Primer
(F):5'- GCCAACATATTCTGCACCG -3'
(R):5'- CACCTGAGATGTGATGGGGAG -3'
Posted On2015-06-24