Mutagenetix > Incidental Mutation

Incidental Mutation 'R4323:Mitf'

323912

Institutional Source

Beutler Lab

Gene Symbol

Mitf

Ensembl Gene

ENSMUSG00000035158

Gene Name

melanogenesis associated transcription factor

Synonyms

wh, mi, Gsfbcc2, bHLHe32, BCC2

MMRRC Submission

041094-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R4323 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97807052-98021349 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97991949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 10 (Y10C)

Ref Sequence

ENSEMBL: ENSMUSP00000144988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043628] [ENSMUST00000043637] [ENSMUST00000101123] [ENSMUST00000113339] [ENSMUST00000139462] [ENSMUST00000203884] [ENSMUST00000203938]

AlphaFold

Q08874

Predicted Effect

probably benign
Transcript: ENSMUST00000043628
AA Change: Y10C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000044459
Gene: ENSMUSG00000035158
AA Change: Y10C

Domain	Start	End	E-Value	Type
HLH	210	263	5.53e-17	SMART
Pfam:DUF3371	290	416	9.5e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000043637

SMART Domains

Protein: ENSMUSP00000044938
Gene: ENSMUSG00000035158

Domain	Start	End	E-Value	Type
low complexity region	34	44	N/A	INTRINSIC
Pfam:MITF_TFEB_C_3_N	56	228	3.1e-52	PFAM
HLH	317	370	5.53e-17	SMART
Pfam:DUF3371	397	522	2.7e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101123

SMART Domains

Protein: ENSMUSP00000098683
Gene: ENSMUSG00000035158

Domain	Start	End	E-Value	Type
coiled coil region	44	74	N/A	INTRINSIC
HLH	301	354	5.53e-17	SMART
Pfam:DUF3371	381	507	4.8e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113339

SMART Domains

Protein: ENSMUSP00000108965
Gene: ENSMUSG00000035158

Domain	Start	End	E-Value	Type
coiled coil region	35	65	N/A	INTRINSIC
HLH	292	345	5.53e-17	SMART
Pfam:DUF3371	372	498	4.6e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139462
AA Change: Y10C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

probably benign
Transcript: ENSMUST00000203884

SMART Domains

Protein: ENSMUSP00000145132
Gene: ENSMUSG00000035158

Domain	Start	End	E-Value	Type
low complexity region	34	44	N/A	INTRINSIC
Pfam:MITF_TFEB_C_3_N	56	228	2.2e-49	PFAM
HLH	311	364	2.3e-19	SMART
Pfam:DUF3371	391	516	1.9e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203938
AA Change: Y10C

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000144988
Gene: ENSMUSG00000035158
AA Change: Y10C

Domain	Start	End	E-Value	Type
Pfam:MITF_TFEB_C_3_N	7	60	2.2e-7	PFAM
HLH	148	201	2.3e-19	SMART
Pfam:DUF3371	228	353	9.2e-36	PFAM

Meta Mutation Damage Score

0.1179

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: This transcription factor serves at a critical point between extracellular signaling and downstream targets in cell specification in early eye and neural crest development. Mutant alleles have been identified that generate distinct phenotypes. Some of these alleles are being used to model the human diseases Waardenburg syndrome IIa and Tietz syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect development of melanocytes, mast cells, osteoclasts and pigmented epithelium. Mutants variably display lack of pigment in coat and eye, microphthalmia, hearing loss, bone resorption anomalies, mast cell deficiency and lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	G	4: 62,547,311	Y414C	probably damaging	Het
Akr1b3	T	C	6: 34,310,927	T166A	probably benign	Het
Ankhd1	C	T	18: 36,578,633	S94L	probably damaging	Het
B4galt3	G	T	1: 171,275,942	M68I	possibly damaging	Het
Bpnt1	A	C	1: 185,356,589	H312P	probably benign	Het
Ccdc178	T	A	18: 22,033,543	K530*	probably null	Het
Ccdc191	A	G	16: 43,947,509	E624G	probably damaging	Het
Clasp2	T	C	9: 113,889,959	V724A	possibly damaging	Het
Copa	G	T	1: 172,119,264	C1022F	probably damaging	Het
Cwf19l2	T	G	9: 3,430,452	F261L	probably damaging	Het
Esr1	G	A	10: 5,001,307	V562M	possibly damaging	Het
Fap	T	C	2: 62,503,372	H643R	probably damaging	Het
Fbxo38	T	A	18: 62,515,161	M769L	probably benign	Het
Fgfr1	A	G	8: 25,573,899	N814S	probably benign	Het
Gm15448	A	G	7: 3,822,755	S372P	possibly damaging	Het
Hipk3	C	A	2: 104,446,571	V388L	probably damaging	Het
Hspa1l	T	A	17: 34,977,856	Y290*	probably null	Het
Itsn1	G	A	16: 91,818,552		probably benign	Het
Jam2	T	C	16: 84,822,856		probably benign	Het
Kprp	G	A	3: 92,824,856	R296W	probably damaging	Het
Med23	T	C	10: 24,870,705	I14T	probably benign	Het
Mpo	T	C	11: 87,796,039	S165P	probably damaging	Het
Neb	T	G	2: 52,264,110	M2330L	possibly damaging	Het
Nup214	T	C	2: 31,994,684	S486P	probably benign	Het
Olfr1392	G	A	11: 49,293,676	M118I	probably damaging	Het
Parp6	G	A	9: 59,630,686	V205I	possibly damaging	Het
Pate2	A	T	9: 35,670,471		probably benign	Het
Pdss1	T	C	2: 22,912,596		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sept1	G	A	7: 127,217,028	P77S	probably damaging	Het
Slitrk3	A	G	3: 73,050,785	L218P	probably damaging	Het
Sltm	T	C	9: 70,580,247	I521T	probably benign	Het
Smchd1	A	G	17: 71,428,275	I618T	probably benign	Het
Sox6	A	G	7: 115,580,563		probably null	Het
Sp8	A	G	12: 118,848,436	I9V	probably benign	Het
Usp9y	T	A	Y: 1,434,407	M352L	possibly damaging	Het
Vmn1r46	T	C	6: 89,976,367	M66T	probably benign	Het
Vmn2r111	A	T	17: 22,573,178	N32K	probably benign	Het
Vmn2r63	A	G	7: 42,926,982	F469S	probably benign	Het
Vps13d	T	A	4: 145,152,778	T1486S	probably benign	Het
Wdr55	A	G	18: 36,763,100	N281S	probably benign	Het
Zswim6	G	A	13: 107,889,403		noncoding transcript	Het

Other mutations in Mitf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01407:Mitf	APN	6	98017931	missense	possibly damaging	0.69
IGL01516:Mitf	APN	6	98010390	splice site	probably null
IGL01617:Mitf	APN	6	97996428	missense	probably benign	0.00
IGL01875:Mitf	APN	6	98017895	missense	probably benign	0.22
R0010:Mitf	UTSW	6	97807281	missense	probably benign	0.25
R0010:Mitf	UTSW	6	97807281	missense	probably benign	0.25
R0079:Mitf	UTSW	6	97996440	missense	probably benign	0.00
R0381:Mitf	UTSW	6	97993143	missense	probably damaging	1.00
R0494:Mitf	UTSW	6	97994429	missense	probably benign	0.00
R0633:Mitf	UTSW	6	98003904	missense	probably damaging	0.98
R0829:Mitf	UTSW	6	98003908	missense	possibly damaging	0.46
R1189:Mitf	UTSW	6	98006125	missense	possibly damaging	0.67
R1459:Mitf	UTSW	6	98010467	missense	probably damaging	1.00
R1766:Mitf	UTSW	6	97941099	missense	probably damaging	1.00
R1864:Mitf	UTSW	6	98010422	missense	probably damaging	1.00
R1891:Mitf	UTSW	6	97941276	missense	probably benign	0.00
R3934:Mitf	UTSW	6	97993253	missense	probably damaging	1.00
R3936:Mitf	UTSW	6	97993253	missense	probably damaging	1.00
R5052:Mitf	UTSW	6	98010445	missense	possibly damaging	0.91
R5097:Mitf	UTSW	6	97996462	missense	possibly damaging	0.63
R5297:Mitf	UTSW	6	97994430	missense	probably benign	0.09
R5646:Mitf	UTSW	6	98013694	missense	probably damaging	1.00
R6109:Mitf	UTSW	6	97996468	missense	probably damaging	1.00
R6351:Mitf	UTSW	6	98003912	missense	possibly damaging	0.85
R6411:Mitf	UTSW	6	98010472	critical splice donor site	probably null
R7855:Mitf	UTSW	6	97993196	missense	probably damaging	1.00
R7904:Mitf	UTSW	6	98013710	missense	probably damaging	0.99
R7975:Mitf	UTSW	6	98018029	missense	probably benign	0.17
R8061:Mitf	UTSW	6	97993298	missense	probably damaging	0.98
R9135:Mitf	UTSW	6	98013719	missense	probably damaging	1.00
R9187:Mitf	UTSW	6	98017874	missense	probably benign	0.05
R9261:Mitf	UTSW	6	98013743	missense	possibly damaging	0.86
R9795:Mitf	UTSW	6	97993182	missense	probably benign
Z1177:Mitf	UTSW	6	98006121	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTGTGATAACGTCTCCG -3'
(R):5'- ACTGGGGAAAGAAATCTTCCTGC -3'

Sequencing Primer
(F):5'- TGATAACGTCTCCGGCGGTG -3'
(R):5'- GGGAAAGAAATCTTCCTGCTATTTAC -3'

Posted On

2015-06-24