Incidental Mutation 'R4323:Sltm'
ID323921
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission 041094-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4323 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70580247 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 521 (I521T)
Ref Sequence ENSEMBL: ENSMUSP00000150324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect unknown
Transcript: ENSMUST00000049263
AA Change: I521T
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: I521T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214834
Predicted Effect unknown
Transcript: ENSMUST00000216816
AA Change: I503T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216881
Predicted Effect probably benign
Transcript: ENSMUST00000217593
AA Change: I521T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,547,311 Y414C probably damaging Het
Akr1b3 T C 6: 34,310,927 T166A probably benign Het
Ankhd1 C T 18: 36,578,633 S94L probably damaging Het
B4galt3 G T 1: 171,275,942 M68I possibly damaging Het
Bpnt1 A C 1: 185,356,589 H312P probably benign Het
Ccdc178 T A 18: 22,033,543 K530* probably null Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Clasp2 T C 9: 113,889,959 V724A possibly damaging Het
Copa G T 1: 172,119,264 C1022F probably damaging Het
Cwf19l2 T G 9: 3,430,452 F261L probably damaging Het
Esr1 G A 10: 5,001,307 V562M possibly damaging Het
Fap T C 2: 62,503,372 H643R probably damaging Het
Fbxo38 T A 18: 62,515,161 M769L probably benign Het
Fgfr1 A G 8: 25,573,899 N814S probably benign Het
Gm15448 A G 7: 3,822,755 S372P possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Hspa1l T A 17: 34,977,856 Y290* probably null Het
Itsn1 G A 16: 91,818,552 probably benign Het
Jam2 T C 16: 84,822,856 probably benign Het
Kprp G A 3: 92,824,856 R296W probably damaging Het
Med23 T C 10: 24,870,705 I14T probably benign Het
Mitf A G 6: 97,991,949 Y10C probably benign Het
Mpo T C 11: 87,796,039 S165P probably damaging Het
Neb T G 2: 52,264,110 M2330L possibly damaging Het
Nup214 T C 2: 31,994,684 S486P probably benign Het
Olfr1392 G A 11: 49,293,676 M118I probably damaging Het
Parp6 G A 9: 59,630,686 V205I possibly damaging Het
Pate2 A T 9: 35,670,471 probably benign Het
Pdss1 T C 2: 22,912,596 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sept1 G A 7: 127,217,028 P77S probably damaging Het
Slitrk3 A G 3: 73,050,785 L218P probably damaging Het
Smchd1 A G 17: 71,428,275 I618T probably benign Het
Sox6 A G 7: 115,580,563 probably null Het
Sp8 A G 12: 118,848,436 I9V probably benign Het
Usp9y T A Y: 1,434,407 M352L possibly damaging Het
Vmn1r46 T C 6: 89,976,367 M66T probably benign Het
Vmn2r111 A T 17: 22,573,178 N32K probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Vps13d T A 4: 145,152,778 T1486S probably benign Het
Wdr55 A G 18: 36,763,100 N281S probably benign Het
Zswim6 G A 13: 107,889,403 noncoding transcript Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6297:Sltm UTSW 9 70581359 missense probably damaging 0.99
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CGATAGCTCTCCAGTAAGACTG -3'
(R):5'- TGTCCTTGTAGCAGGAAGGG -3'

Sequencing Primer
(F):5'- GGCTTCTGATAGACACATGACTGC -3'
(R):5'- GGGAAAACTTGGTCTATAAATCCCC -3'
Posted On2015-06-24