Incidental Mutation 'R4323:Ccdc191'
ID 323927
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission 041094-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R4323 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 43710172-43784677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43767872 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000116078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect probably damaging
Transcript: ENSMUST00000122440
AA Change: E267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: E267G

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: E624G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: E624G

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145999
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: E682G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: E682G

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A G 4: 62,465,548 (GRCm39) Y414C probably damaging Het
Akr1b1 T C 6: 34,287,862 (GRCm39) T166A probably benign Het
Ankhd1 C T 18: 36,711,686 (GRCm39) S94L probably damaging Het
B4galt3 G T 1: 171,103,515 (GRCm39) M68I possibly damaging Het
Bpnt1 A C 1: 185,088,786 (GRCm39) H312P probably benign Het
Ccdc178 T A 18: 22,166,600 (GRCm39) K530* probably null Het
Clasp2 T C 9: 113,719,027 (GRCm39) V724A possibly damaging Het
Copa G T 1: 171,946,831 (GRCm39) C1022F probably damaging Het
Cwf19l2 T G 9: 3,430,452 (GRCm39) F261L probably damaging Het
Esr1 G A 10: 4,951,307 (GRCm39) V562M possibly damaging Het
Fap T C 2: 62,333,716 (GRCm39) H643R probably damaging Het
Fbxo38 T A 18: 62,648,232 (GRCm39) M769L probably benign Het
Fgfr1 A G 8: 26,063,915 (GRCm39) N814S probably benign Het
Hipk3 C A 2: 104,276,916 (GRCm39) V388L probably damaging Het
Hspa1l T A 17: 35,196,832 (GRCm39) Y290* probably null Het
Itsn1 G A 16: 91,615,440 (GRCm39) probably benign Het
Jam2 T C 16: 84,619,744 (GRCm39) probably benign Het
Kprp G A 3: 92,732,163 (GRCm39) R296W probably damaging Het
Med23 T C 10: 24,746,603 (GRCm39) I14T probably benign Het
Mitf A G 6: 97,968,910 (GRCm39) Y10C probably benign Het
Mpo T C 11: 87,686,865 (GRCm39) S165P probably damaging Het
Neb T G 2: 52,154,122 (GRCm39) M2330L possibly damaging Het
Nup214 T C 2: 31,884,696 (GRCm39) S486P probably benign Het
Or2y1f G A 11: 49,184,503 (GRCm39) M118I probably damaging Het
Parp6 G A 9: 59,537,969 (GRCm39) V205I possibly damaging Het
Pate2 A T 9: 35,581,767 (GRCm39) probably benign Het
Pdss1 T C 2: 22,802,608 (GRCm39) probably benign Het
Pira13 A G 7: 3,825,754 (GRCm39) S372P possibly damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Septin1 G A 7: 126,816,200 (GRCm39) P77S probably damaging Het
Slitrk3 A G 3: 72,958,118 (GRCm39) L218P probably damaging Het
Sltm T C 9: 70,487,529 (GRCm39) I521T probably benign Het
Smchd1 A G 17: 71,735,270 (GRCm39) I618T probably benign Het
Sox6 A G 7: 115,179,798 (GRCm39) probably null Het
Sp8 A G 12: 118,812,171 (GRCm39) I9V probably benign Het
Usp9y T A Y: 1,434,407 (GRCm39) M352L possibly damaging Het
Vmn1r46 T C 6: 89,953,349 (GRCm39) M66T probably benign Het
Vmn2r111 A T 17: 22,792,159 (GRCm39) N32K probably benign Het
Vmn2r63 A G 7: 42,576,406 (GRCm39) F469S probably benign Het
Vps13d T A 4: 144,879,348 (GRCm39) T1486S probably benign Het
Wdr55 A G 18: 36,896,153 (GRCm39) N281S probably benign Het
Zswim6 G A 13: 108,025,938 (GRCm39) noncoding transcript Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43,779,663 (GRCm39) missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43,780,385 (GRCm39) missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43,777,257 (GRCm39) missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43,780,462 (GRCm39) missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43,742,164 (GRCm39) intron probably benign
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0346:Ccdc191 UTSW 16 43,759,315 (GRCm39) missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43,751,704 (GRCm39) nonsense probably null
R0907:Ccdc191 UTSW 16 43,735,901 (GRCm39) missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43,751,618 (GRCm39) missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43,763,873 (GRCm39) missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43,728,998 (GRCm39) missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43,751,561 (GRCm39) missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43,764,330 (GRCm39) splice site probably null
R3104:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43,751,646 (GRCm39) missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43,759,536 (GRCm39) splice site probably benign
R4788:Ccdc191 UTSW 16 43,777,185 (GRCm39) missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43,763,868 (GRCm39) missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43,728,976 (GRCm39) missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43,735,848 (GRCm39) missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43,767,820 (GRCm39) nonsense probably null
R7543:Ccdc191 UTSW 16 43,718,572 (GRCm39) nonsense probably null
R7843:Ccdc191 UTSW 16 43,779,699 (GRCm39) missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43,735,968 (GRCm39) critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43,710,262 (GRCm39) start gained probably benign
R8984:Ccdc191 UTSW 16 43,710,581 (GRCm39) intron probably benign
R8987:Ccdc191 UTSW 16 43,751,710 (GRCm39) missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43,718,512 (GRCm39) missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43,725,831 (GRCm39) missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43,764,041 (GRCm39) nonsense probably null
R9448:Ccdc191 UTSW 16 43,759,338 (GRCm39) missense
R9507:Ccdc191 UTSW 16 43,764,192 (GRCm39) missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43,762,170 (GRCm39) missense
Z1177:Ccdc191 UTSW 16 43,759,485 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATACTTTGCTGCCTCAGGACC -3'
(R):5'- GTAAGGTCCTATCTTTTCAACTAGC -3'

Sequencing Primer
(F):5'- TGCTGCCTCAGGACCAAAGAC -3'
(R):5'- GCATTTAATAACTTGCTTTCCCAG -3'
Posted On 2015-06-24