Incidental Mutation 'R4324:Dsel'
ID323941
Institutional Source Beutler Lab
Gene Symbol Dsel
Ensembl Gene ENSMUSG00000038702
Gene Namedermatan sulfate epimerase-like
Synonyms9330132E09Rik, DS-epi2
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location111858702-111864918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111861393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 471 (T471A)
Ref Sequence ENSEMBL: ENSMUSP00000043570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035462]
Predicted Effect probably damaging
Transcript: ENSMUST00000035462
AA Change: T471A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043570
Gene: ENSMUSG00000038702
AA Change: T471A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
transmembrane domain 769 791 N/A INTRINSIC
transmembrane domain 798 817 N/A INTRINSIC
Pfam:Sulfotransfer_1 847 1201 2.1e-12 PFAM
Pfam:Sulfotransfer_3 848 1143 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189731
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced epimerase activity in the skin, lung, liver, spleen, kidney and brain and reduced iduronic acid content in the brain and kidney chondroitin sulfate/dermatan sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Dsel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dsel APN 1 111860061 nonsense probably null
IGL01562:Dsel APN 1 111860319 missense probably benign
IGL01591:Dsel APN 1 111859695 missense probably benign 0.08
IGL01822:Dsel APN 1 111861896 missense probably damaging 1.00
IGL02289:Dsel APN 1 111860102 nonsense probably null
IGL02557:Dsel APN 1 111862570 missense probably damaging 1.00
IGL02805:Dsel APN 1 111862316 missense probably damaging 1.00
IGL02864:Dsel APN 1 111859214 missense probably damaging 1.00
IGL02887:Dsel APN 1 111860732 missense possibly damaging 0.90
IGL03092:Dsel APN 1 111860063 missense probably damaging 1.00
IGL03117:Dsel APN 1 111859178 utr 3 prime probably benign
IGL03182:Dsel APN 1 111860138 missense probably damaging 0.99
rudolph UTSW 1 111859817 missense probably damaging 0.99
R0196:Dsel UTSW 1 111861603 missense possibly damaging 0.86
R0465:Dsel UTSW 1 111862262 missense probably benign 0.00
R0725:Dsel UTSW 1 111859952 missense possibly damaging 0.79
R1024:Dsel UTSW 1 111860673 missense probably damaging 1.00
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1147:Dsel UTSW 1 111862209 missense possibly damaging 0.71
R1654:Dsel UTSW 1 111862512 missense probably damaging 1.00
R1728:Dsel UTSW 1 111859457 missense probably benign
R1728:Dsel UTSW 1 111859994 missense probably benign
R1729:Dsel UTSW 1 111859457 missense probably benign
R1729:Dsel UTSW 1 111859994 missense probably benign
R1730:Dsel UTSW 1 111859457 missense probably benign
R1730:Dsel UTSW 1 111859994 missense probably benign
R1735:Dsel UTSW 1 111860915 missense probably damaging 1.00
R1739:Dsel UTSW 1 111859457 missense probably benign
R1739:Dsel UTSW 1 111859994 missense probably benign
R1762:Dsel UTSW 1 111859457 missense probably benign
R1762:Dsel UTSW 1 111859994 missense probably benign
R1783:Dsel UTSW 1 111859457 missense probably benign
R1783:Dsel UTSW 1 111859994 missense probably benign
R1785:Dsel UTSW 1 111859457 missense probably benign
R1785:Dsel UTSW 1 111859994 missense probably benign
R2049:Dsel UTSW 1 111859457 missense probably benign
R2080:Dsel UTSW 1 111859962 missense probably benign
R2141:Dsel UTSW 1 111859457 missense probably benign
R2142:Dsel UTSW 1 111859457 missense probably benign
R2150:Dsel UTSW 1 111860257 missense probably benign 0.04
R5378:Dsel UTSW 1 111862821 start gained probably benign
R5881:Dsel UTSW 1 111859438 missense probably damaging 1.00
R5919:Dsel UTSW 1 111860253 missense probably benign
R6820:Dsel UTSW 1 111859817 missense probably damaging 0.99
R7003:Dsel UTSW 1 111860295 missense probably benign
R7064:Dsel UTSW 1 111862847 start gained probably benign
R7297:Dsel UTSW 1 111861776 missense probably damaging 1.00
R7340:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7341:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7343:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7346:Dsel UTSW 1 111861068 missense probably damaging 1.00
R7347:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7365:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7366:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7367:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7393:Dsel UTSW 1 111861573 missense probably damaging 1.00
R7974:Dsel UTSW 1 111860499 missense probably benign 0.00
R7978:Dsel UTSW 1 111859719 nonsense probably null
R8220:Dsel UTSW 1 111861707 missense probably damaging 1.00
R8434:Dsel UTSW 1 111861655 missense probably damaging 1.00
X0057:Dsel UTSW 1 111859210 missense probably benign
Z1177:Dsel UTSW 1 111861716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAATAACTTCCCCAGCTGC -3'
(R):5'- GCACACATTTCCTAACTGGGG -3'

Sequencing Primer
(F):5'- GTAATAACTTCCCCAGCTGCATCAC -3'
(R):5'- ACACATTTCCTAACTGGGGTGTCG -3'
Posted On2015-06-24