Incidental Mutation 'R4324:Gad1'
ID323942
Institutional Source Beutler Lab
Gene Symbol Gad1
Ensembl Gene ENSMUSG00000070880
Gene Nameglutamate decarboxylase 1
SynonymsGAD25, GAD67, Gad-1, Z49976, GAD44, EP10
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70553072-70602014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70589830 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 353 (D353N)
Ref Sequence ENSEMBL: ENSMUSP00000092539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094934] [ENSMUST00000123330] [ENSMUST00000130604] [ENSMUST00000130998]
Predicted Effect probably damaging
Transcript: ENSMUST00000094934
AA Change: D353N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092539
Gene: ENSMUSG00000070880
AA Change: D353N

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 517 7e-154 PFAM
Pfam:Beta_elim_lyase 231 375 3.2e-6 PFAM
Pfam:Aminotran_5 273 380 2.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123330
SMART Domains Protein: ENSMUSP00000116301
Gene: ENSMUSG00000070880

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 249 6.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130604
SMART Domains Protein: ENSMUSP00000117721
Gene: ENSMUSG00000070880

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 218 2.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130998
SMART Domains Protein: ENSMUSP00000119379
Gene: ENSMUSG00000070880

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:Pyridoxal_deC 143 218 2.9e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140478
Meta Mutation Damage Score 0.4441 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an enzyme that catalyzes the production of gamma-aminobutyric acid from L-glutamic acid. Alternative splicing of this gene results in two products, the predominant 67 kDa isoform and a smaller 25 kDa isoform. The smaller isoform is not thought to retain catalytic activity. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at birth with cleft palate and apnea and exhibit reduced levels of glutamic acid decarboxylase and gamma-aminobutyric acid in the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Gad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Gad1 APN 2 70597168 missense probably benign
IGL01907:Gad1 APN 2 70574126 missense possibly damaging 0.64
IGL02596:Gad1 APN 2 70594684 missense probably damaging 1.00
IGL02654:Gad1 APN 2 70572781 missense possibly damaging 0.88
IGL02998:Gad1 APN 2 70589819 missense probably damaging 1.00
PIT4581001:Gad1 UTSW 2 70599667 missense probably benign 0.05
R0102:Gad1 UTSW 2 70587239 critical splice donor site probably null
R0454:Gad1 UTSW 2 70579201 missense probably damaging 1.00
R0576:Gad1 UTSW 2 70594652 missense probably benign 0.27
R1386:Gad1 UTSW 2 70574123 missense possibly damaging 0.88
R1677:Gad1 UTSW 2 70574177 missense probably damaging 1.00
R1842:Gad1 UTSW 2 70574253 missense probably benign 0.12
R1907:Gad1 UTSW 2 70579138 missense possibly damaging 0.79
R1933:Gad1 UTSW 2 70587392 missense possibly damaging 0.91
R3029:Gad1 UTSW 2 70594690 missense probably benign
R4085:Gad1 UTSW 2 70589848 missense probably benign 0.36
R4321:Gad1 UTSW 2 70589830 missense probably damaging 1.00
R4687:Gad1 UTSW 2 70600720 missense possibly damaging 0.94
R4986:Gad1 UTSW 2 70600693 missense probably benign
R5387:Gad1 UTSW 2 70563851 nonsense probably null
R5603:Gad1 UTSW 2 70589829 missense probably damaging 0.98
R6500:Gad1 UTSW 2 70593436 missense probably damaging 0.98
R7146:Gad1 UTSW 2 70587362 missense probably benign 0.00
R7352:Gad1 UTSW 2 70594750 missense probably benign 0.00
R7559:Gad1 UTSW 2 70563912 critical splice donor site probably null
R7579:Gad1 UTSW 2 70587132 missense possibly damaging 0.90
R7809:Gad1 UTSW 2 70597259 missense possibly damaging 0.80
R8290:Gad1 UTSW 2 70574266 missense probably benign 0.00
R8353:Gad1 UTSW 2 70600713 missense probably benign 0.00
R8453:Gad1 UTSW 2 70600713 missense probably benign 0.00
X0026:Gad1 UTSW 2 70589866 missense probably benign 0.00
Z1177:Gad1 UTSW 2 70579130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGTAGAAACAAGCAGATG -3'
(R):5'- CTGTGGCATGCACTGTTCAC -3'

Sequencing Primer
(F):5'- TCTAAGAGGGCATACCACTCTTG -3'
(R):5'- GCAGGAGCTAACATAGGTGG -3'
Posted On2015-06-24