Incidental Mutation 'R4324:Shc4'
ID323945
Institutional Source Beutler Lab
Gene Symbol Shc4
Ensembl Gene ENSMUSG00000035109
Gene NameSHC (Src homology 2 domain containing) family, member 4
Synonyms9930029B02Rik, LOC271849, 6230417E10Rik
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125627447-125724148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125678750 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 260 (M260L)
Ref Sequence ENSEMBL: ENSMUSP00000043146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042246] [ENSMUST00000164756]
Predicted Effect probably benign
Transcript: ENSMUST00000042246
AA Change: M260L

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043146
Gene: ENSMUSG00000035109
AA Change: M260L

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
PTB 187 351 1.38e-34 SMART
SH2 520 599 4.69e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164756
SMART Domains Protein: ENSMUSP00000129413
Gene: ENSMUSG00000091337

DomainStartEndE-ValueType
low complexity region 31 58 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Shc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02298:Shc4 APN 2 125649154 missense probably damaging 0.96
IGL03003:Shc4 APN 2 125723333 nonsense probably null
R0167:Shc4 UTSW 2 125723013 missense probably benign 0.00
R0784:Shc4 UTSW 2 125657496 missense probably benign 0.08
R0959:Shc4 UTSW 2 125678687 critical splice donor site probably null
R1099:Shc4 UTSW 2 125722844 missense probably benign 0.03
R1864:Shc4 UTSW 2 125639367 missense probably damaging 1.00
R2198:Shc4 UTSW 2 125639346 missense possibly damaging 0.46
R3791:Shc4 UTSW 2 125723331 missense probably damaging 0.97
R4424:Shc4 UTSW 2 125652522 missense probably benign
R4611:Shc4 UTSW 2 125655682 missense probably benign 0.29
R4745:Shc4 UTSW 2 125649277 missense probably damaging 0.96
R5037:Shc4 UTSW 2 125629727 missense probably damaging 1.00
R5433:Shc4 UTSW 2 125639430 missense probably damaging 1.00
R5754:Shc4 UTSW 2 125670298 missense probably damaging 1.00
R7795:Shc4 UTSW 2 125723365 missense probably damaging 0.99
R8058:Shc4 UTSW 2 125649234 nonsense probably null
R8314:Shc4 UTSW 2 125655616 missense possibly damaging 0.56
R8396:Shc4 UTSW 2 125629697 missense probably damaging 1.00
Z1177:Shc4 UTSW 2 125722923 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATCAATGTTGGGAAATTTGCC -3'
(R):5'- ATGCGCTTCCATCTCCACAG -3'

Sequencing Primer
(F):5'- CAATGTTGGGAAATTTGCCCTTTTTG -3'
(R):5'- AAGGACCAAGCTTTGATCAAGTC -3'
Posted On2015-06-24