Incidental Mutation 'R4324:Atxn7l2'
ID323949
Institutional Source Beutler Lab
Gene Symbol Atxn7l2
Ensembl Gene ENSMUSG00000048997
Gene Nameataxin 7-like 2
Synonyms
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108202222-108210934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108205832 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 218 (D218E)
Ref Sequence ENSEMBL: ENSMUSP00000113020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065664] [ENSMUST00000102633] [ENSMUST00000106655] [ENSMUST00000117409] [ENSMUST00000117784] [ENSMUST00000119650] [ENSMUST00000127157]
Predicted Effect probably benign
Transcript: ENSMUST00000065664
SMART Domains Protein: ENSMUSP00000070361
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
B561 1 127 5.49e-40 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102633
AA Change: D253E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099693
Gene: ENSMUSG00000048997
AA Change: D253E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 198 265 3.9e-29 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106655
SMART Domains Protein: ENSMUSP00000102266
Gene: ENSMUSG00000048796

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
B561 54 185 4.96e-47 SMART
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117409
AA Change: D221E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112976
Gene: ENSMUSG00000048997
AA Change: D221E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 164 235 1.2e-31 PFAM
low complexity region 301 320 N/A INTRINSIC
low complexity region 324 331 N/A INTRINSIC
low complexity region 403 420 N/A INTRINSIC
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117784
AA Change: D253E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114031
Gene: ENSMUSG00000048997
AA Change: D253E

DomainStartEndE-ValueType
low complexity region 55 63 N/A INTRINSIC
Pfam:SCA7 196 267 1.6e-31 PFAM
low complexity region 333 352 N/A INTRINSIC
low complexity region 356 363 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
low complexity region 515 532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119650
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113020
Gene: ENSMUSG00000048997
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
Pfam:SCA7 161 232 1.2e-31 PFAM
low complexity region 298 317 N/A INTRINSIC
low complexity region 321 328 N/A INTRINSIC
low complexity region 400 417 N/A INTRINSIC
low complexity region 480 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127157
SMART Domains Protein: ENSMUSP00000119223
Gene: ENSMUSG00000048997

DomainStartEndE-ValueType
Blast:ZnF_C2H2 23 45 1e-5 BLAST
low complexity region 55 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196823
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Atxn7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Atxn7l2 APN 3 108203543 missense probably damaging 1.00
IGL02381:Atxn7l2 APN 3 108204495 unclassified probably benign
IGL03179:Atxn7l2 APN 3 108203647 nonsense probably null
R0610:Atxn7l2 UTSW 3 108204774 missense possibly damaging 0.80
R1454:Atxn7l2 UTSW 3 108208432 unclassified probably benign
R2474:Atxn7l2 UTSW 3 108203977 missense probably damaging 0.96
R4319:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4322:Atxn7l2 UTSW 3 108205832 missense probably damaging 1.00
R4797:Atxn7l2 UTSW 3 108204550 missense probably damaging 1.00
R5825:Atxn7l2 UTSW 3 108204811 missense probably damaging 1.00
R5916:Atxn7l2 UTSW 3 108205662 splice site probably null
R7706:Atxn7l2 UTSW 3 108207403 missense probably damaging 0.98
R8109:Atxn7l2 UTSW 3 108203301 missense probably damaging 1.00
Z1176:Atxn7l2 UTSW 3 108205666 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCACAGTACGGATAGGTCTG -3'
(R):5'- AGATCCCTTACCCAGAGGAG -3'

Sequencing Primer
(F):5'- CACAGTACGGATAGGTCTGCTTAGAC -3'
(R):5'- CCTTACCCAGAGGAGAGTTTTCG -3'
Posted On2015-06-24