Incidental Mutation 'R4324:Cdk14'
ID323953
Institutional Source Beutler Lab
Gene Symbol Cdk14
Ensembl Gene ENSMUSG00000028926
Gene Namecyclin-dependent kinase 14
SynonymsPftk1
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location4803391-5420312 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 5036532 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 263 (K263*)
Ref Sequence ENSEMBL: ENSMUSP00000111112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030763] [ENSMUST00000115450] [ENSMUST00000115451] [ENSMUST00000115452]
Predicted Effect probably null
Transcript: ENSMUST00000030763
AA Change: K281*
SMART Domains Protein: ENSMUSP00000030763
Gene: ENSMUSG00000028926
AA Change: K281*

DomainStartEndE-ValueType
low complexity region 119 127 N/A INTRINSIC
S_TKc 135 419 3.63e-85 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115450
AA Change: K235*
SMART Domains Protein: ENSMUSP00000111110
Gene: ENSMUSG00000028926
AA Change: K235*

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115451
AA Change: K235*
SMART Domains Protein: ENSMUSP00000111111
Gene: ENSMUSG00000028926
AA Change: K235*

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115452
AA Change: K263*
SMART Domains Protein: ENSMUSP00000111112
Gene: ENSMUSG00000028926
AA Change: K263*

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
S_TKc 117 401 3.63e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156660
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PFTK1 is a member of the CDC2 (MIM 116940)-related protein kinase family (Yang and Chen, 2001 [PubMed 11313143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Cdk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Cdk14 APN 5 5249237 splice site probably benign
IGL01376:Cdk14 APN 5 5010839 missense probably damaging 1.00
IGL02102:Cdk14 APN 5 5380083 missense probably benign 0.01
IGL02179:Cdk14 APN 5 5103845 missense probably damaging 1.00
IGL02423:Cdk14 APN 5 4888905 missense probably benign 0.00
IGL03081:Cdk14 APN 5 4949527 splice site probably benign
IGL02988:Cdk14 UTSW 5 5036484 missense probably damaging 1.00
R0465:Cdk14 UTSW 5 5093019 missense probably damaging 1.00
R0630:Cdk14 UTSW 5 5135422 splice site probably benign
R1452:Cdk14 UTSW 5 4888927 missense possibly damaging 0.85
R1601:Cdk14 UTSW 5 5135378 missense probably damaging 1.00
R1629:Cdk14 UTSW 5 5103807 missense probably benign 0.18
R1659:Cdk14 UTSW 5 4949571 missense probably benign 0.08
R1809:Cdk14 UTSW 5 5010901 missense probably damaging 0.98
R2013:Cdk14 UTSW 5 5093047 missense probably damaging 1.00
R2015:Cdk14 UTSW 5 5380082 missense probably benign
R2256:Cdk14 UTSW 5 4888924 missense probably benign
R2257:Cdk14 UTSW 5 4888924 missense probably benign
R2908:Cdk14 UTSW 5 5249051 missense probably benign 0.33
R4432:Cdk14 UTSW 5 5036427 missense probably damaging 1.00
R4907:Cdk14 UTSW 5 5249140 missense probably damaging 0.96
R5426:Cdk14 UTSW 5 4888975 missense possibly damaging 0.93
R5708:Cdk14 UTSW 5 5266036 intron probably benign
R6006:Cdk14 UTSW 5 5249211 start codon destroyed probably null 0.33
R6120:Cdk14 UTSW 5 4894029 missense probably damaging 0.96
R7048:Cdk14 UTSW 5 5093005 missense probably damaging 1.00
R7104:Cdk14 UTSW 5 5195325 missense possibly damaging 0.92
R7712:Cdk14 UTSW 5 5380061 missense possibly damaging 0.86
R8046:Cdk14 UTSW 5 5249159 missense possibly damaging 0.86
Z1176:Cdk14 UTSW 5 5135322 nonsense probably null
Z1177:Cdk14 UTSW 5 4888894 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATAGGCAAGACTCCTGCAC -3'
(R):5'- AGTCAGGAGATTCTAAAGTGGTTG -3'

Sequencing Primer
(F):5'- AAGACTCCTGCACCATTAATCTTTG -3'
(R):5'- GCTTTATTTGCAGTATGAATGACTTG -3'
Posted On2015-06-24