Incidental Mutation 'R4324:Afp'
ID323955
Institutional Source Beutler Lab
Gene Symbol Afp
Ensembl Gene ENSMUSG00000054932
Gene Namealpha fetoprotein
Synonymsalpha-foetoprotein
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location90490737-90508907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90507905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000041006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042755]
Predicted Effect probably benign
Transcript: ENSMUST00000042755
AA Change: D583G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041006
Gene: ENSMUSG00000054932
AA Change: D583G

DomainStartEndE-ValueType
ALBUMIN 20 201 5.33e-70 SMART
ALBUMIN 208 393 8.52e-69 SMART
ALBUMIN 400 591 6.39e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for targeted null mutations are sterile due to impairment of the hypothalamic/pituitary system and failure of the estrus cycle resulting in anovulation. Homozygous males are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Afp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Afp APN 5 90491751 critical splice donor site probably null
R0018:Afp UTSW 5 90506741 missense probably damaging 1.00
R0387:Afp UTSW 5 90497291 missense probably damaging 1.00
R0529:Afp UTSW 5 90504395 missense probably damaging 1.00
R1401:Afp UTSW 5 90501627 splice site probably benign
R1471:Afp UTSW 5 90503682 missense possibly damaging 0.49
R1666:Afp UTSW 5 90505068 missense probably damaging 0.99
R1800:Afp UTSW 5 90490796 missense probably benign 0.00
R2138:Afp UTSW 5 90499647 missense probably damaging 1.00
R2248:Afp UTSW 5 90501570 missense probably damaging 0.99
R4555:Afp UTSW 5 90506687 missense possibly damaging 0.88
R5035:Afp UTSW 5 90507905 missense probably benign 0.00
R5241:Afp UTSW 5 90501614 missense probably benign 0.37
R5925:Afp UTSW 5 90497288 missense probably damaging 1.00
R6220:Afp UTSW 5 90504410 missense possibly damaging 0.78
R6719:Afp UTSW 5 90503703 missense probably benign 0.01
R8211:Afp UTSW 5 90501486 missense possibly damaging 0.73
Z1088:Afp UTSW 5 90505015 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TAAACGTTCTGGGAAGGTGCG -3'
(R):5'- CGCTCTTAAGTGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- GGCTTTCTTTGCATGGCAGACTC -3'
(R):5'- CTCTTAAGTGAGGTCAGGAGTATTTC -3'
Posted On2015-06-24