Incidental Mutation 'R4324:Epn1'
ID323961
Institutional Source Beutler Lab
Gene Symbol Epn1
Ensembl Gene ENSMUSG00000035203
Gene Nameepsin 1
SynonymsIbp1
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5080235-5098178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5097211 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 441 (M441K)
Ref Sequence ENSEMBL: ENSMUSP00000146638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045277] [ENSMUST00000098845] [ENSMUST00000208634]
Predicted Effect probably benign
Transcript: ENSMUST00000045277
AA Change: M440K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043340
Gene: ENSMUSG00000035203
AA Change: M440K

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098845
AA Change: M440K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096445
Gene: ENSMUSG00000035203
AA Change: M440K

DomainStartEndE-ValueType
ENTH 18 144 5.84e-65 SMART
low complexity region 157 174 N/A INTRINSIC
UIM 183 202 2.94e-1 SMART
UIM 208 227 4.15e-1 SMART
UIM 233 252 5.48e-1 SMART
low complexity region 279 293 N/A INTRINSIC
low complexity region 294 316 N/A INTRINSIC
low complexity region 332 350 N/A INTRINSIC
low complexity region 363 379 N/A INTRINSIC
low complexity region 454 466 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155436
Predicted Effect probably benign
Transcript: ENSMUST00000208634
AA Change: M441K

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epsin protein family. The encoded protein binds clathrin and is involved in the endocytosis of clathrin-coated vesicles. Loss of function of this gene is associated with reduced tumor growth and progression in certain cancer types. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities. Mice homozygous null for both Epn1 and Epn2 display defects in angiogenic vascular remodeling, impaired somitogenesis and extensive cell death in the nervous tissue, resulting in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Epn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Epn1 APN 7 5095036 missense probably benign 0.19
IGL03126:Epn1 APN 7 5095685 missense probably benign 0.01
epsilon UTSW 7 5095048 missense probably benign
R1074:Epn1 UTSW 7 5095048 missense probably benign
R1365:Epn1 UTSW 7 5093370 missense probably benign 0.05
R1848:Epn1 UTSW 7 5089998 missense probably damaging 1.00
R2041:Epn1 UTSW 7 5083875 missense probably damaging 0.99
R2237:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2238:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R2239:Epn1 UTSW 7 5097602 missense probably damaging 0.98
R4255:Epn1 UTSW 7 5097638 missense probably damaging 1.00
R4542:Epn1 UTSW 7 5093981 missense possibly damaging 0.63
R4703:Epn1 UTSW 7 5095148 missense probably damaging 0.99
R4740:Epn1 UTSW 7 5090013 missense probably damaging 1.00
R4845:Epn1 UTSW 7 5093909 missense possibly damaging 0.94
R5838:Epn1 UTSW 7 5097166 nonsense probably null
R5952:Epn1 UTSW 7 5093912 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095926 missense probably damaging 1.00
R6251:Epn1 UTSW 7 5095936 missense probably damaging 1.00
R6296:Epn1 UTSW 7 5090123 missense probably damaging 0.98
R6710:Epn1 UTSW 7 5097304 missense probably damaging 0.99
R6937:Epn1 UTSW 7 5089944 missense probably damaging 1.00
R7196:Epn1 UTSW 7 5093381 missense possibly damaging 0.68
R7420:Epn1 UTSW 7 5097688 missense possibly damaging 0.77
R7948:Epn1 UTSW 7 5089993 nonsense probably null
X0065:Epn1 UTSW 7 5095093 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TAGTCCAAGCTCAGCTCAGC -3'
(R):5'- TCACCGCTTGGAAGGAATGG -3'

Sequencing Primer
(F):5'- AAGCTCAGCTCAGCCTGCC -3'
(R):5'- GGAAGCCTTGGATCCTGG -3'
Posted On2015-06-24