Incidental Mutation 'R4324:Olfr473'
ID323963
Institutional Source Beutler Lab
Gene Symbol Olfr473
Ensembl Gene ENSMUSG00000095212
Gene Nameolfactory receptor 473
SynonymsGA_x6K02T2PBJ9-10262759-10263691, MOR204-4
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107930446-107935661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107933693 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 58 (P58S)
Ref Sequence ENSEMBL: ENSMUSP00000150610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084761] [ENSMUST00000217618]
Predicted Effect probably damaging
Transcript: ENSMUST00000084761
AA Change: P58S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081816
Gene: ENSMUSG00000095212
AA Change: P58S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.4e-49 PFAM
Pfam:7tm_1 41 290 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210626
AA Change: P58S
Predicted Effect probably damaging
Transcript: ENSMUST00000217618
AA Change: P58S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Olfr473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02354:Olfr473 APN 7 107934277 nonsense probably null
IGL02361:Olfr473 APN 7 107934277 nonsense probably null
IGL03228:Olfr473 APN 7 107934123 missense possibly damaging 0.94
R0255:Olfr473 UTSW 7 107934168 missense probably damaging 0.96
R0306:Olfr473 UTSW 7 107933700 missense probably damaging 1.00
R1126:Olfr473 UTSW 7 107934371 missense possibly damaging 0.76
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1313:Olfr473 UTSW 7 107933768 missense probably benign 0.01
R1860:Olfr473 UTSW 7 107934390 missense probably damaging 1.00
R2060:Olfr473 UTSW 7 107933661 missense probably benign 0.00
R2386:Olfr473 UTSW 7 107934273 missense probably damaging 0.99
R4847:Olfr473 UTSW 7 107933827 nonsense probably null
R5926:Olfr473 UTSW 7 107933903 missense probably damaging 0.98
R6964:Olfr473 UTSW 7 107933759 missense probably benign 0.00
R8024:Olfr473 UTSW 7 107934438 missense probably benign 0.00
R8377:Olfr473 UTSW 7 107933685 missense probably damaging 1.00
X0063:Olfr473 UTSW 7 107934345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTCCCTCAACAGGAACAATTC -3'
(R):5'- ATAGCGATCATAGGCCATGGC -3'

Sequencing Primer
(F):5'- TTCACACAAGAGATGGAGGCTG -3'
(R):5'- GCAGCCAGTAGGAAGCACTC -3'
Posted On2015-06-24