Incidental Mutation 'R4324:Cdkn2aip'
ID323966
Institutional Source Beutler Lab
Gene Symbol Cdkn2aip
Ensembl Gene ENSMUSG00000038069
Gene NameCDKN2A interacting protein
SynonymsCARF, 4921511I16Rik
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location47709344-47713932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47712173 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 168 (S168R)
Ref Sequence ENSEMBL: ENSMUSP00000148441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038738] [ENSMUST00000212175]
Predicted Effect probably benign
Transcript: ENSMUST00000038738
SMART Domains Protein: ENSMUSP00000043713
Gene: ENSMUSG00000038069

DomainStartEndE-ValueType
Pfam:XTBD 19 117 1e-34 PFAM
low complexity region 168 199 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 270 280 N/A INTRINSIC
low complexity region 303 356 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
Blast:DSRM 449 514 4e-6 BLAST
low complexity region 515 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180928
SMART Domains Protein: ENSMUSP00000137808
Gene: ENSMUSG00000097706

DomainStartEndE-ValueType
low complexity region 112 120 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
low complexity region 234 239 N/A INTRINSIC
low complexity region 259 292 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212175
AA Change: S168R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212658
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates the DNA damage response through several different signaling pathways. One such pathway is the p53-HDM2-p21(WAF1) pathway, which is critical to the DNA damage response. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Cdkn2aip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cdkn2aip APN 8 47711212 missense probably damaging 0.98
IGL02422:Cdkn2aip APN 8 47711499 missense probably damaging 0.98
IGL03346:Cdkn2aip APN 8 47713618 missense probably benign
R0269:Cdkn2aip UTSW 8 47711977 missense probably damaging 0.99
R0557:Cdkn2aip UTSW 8 47712942 missense probably damaging 0.99
R0788:Cdkn2aip UTSW 8 47713763 missense possibly damaging 0.95
R1915:Cdkn2aip UTSW 8 47711926 missense probably benign 0.24
R1990:Cdkn2aip UTSW 8 47712176 missense probably benign 0.27
R2101:Cdkn2aip UTSW 8 47713001 missense probably damaging 0.98
R3081:Cdkn2aip UTSW 8 47711497 missense probably damaging 0.97
R4765:Cdkn2aip UTSW 8 47713547 missense probably damaging 1.00
R4983:Cdkn2aip UTSW 8 47712929 missense probably damaging 1.00
R4985:Cdkn2aip UTSW 8 47713445 intron probably benign
R6968:Cdkn2aip UTSW 8 47713887 start gained probably benign
R7402:Cdkn2aip UTSW 8 47711373 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAAAGCCTTTCCAGACCCTG -3'
(R):5'- CAAGTCCAATGTCTGATGCTG -3'

Sequencing Primer
(F):5'- GCGGTTACCTGAGAGGAATTGC -3'
(R):5'- CTGGAACTTGCTCTATAGACCAGG -3'
Posted On2015-06-24