Incidental Mutation 'R4324:Fbxw24'
ID323968
Institutional Source Beutler Lab
Gene Symbol Fbxw24
Ensembl Gene ENSMUSG00000062275
Gene NameF-box and WD-40 domain protein 24
SynonymsGm5162
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109601116-109626057 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 109604945 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073962]
Predicted Effect probably null
Transcript: ENSMUST00000073962
SMART Domains Protein: ENSMUSP00000073617
Gene: ENSMUSG00000062275

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1gxra_ 87 227 8e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Fbxw24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Fbxw24 APN 9 109604973 missense probably benign 0.00
IGL01373:Fbxw24 APN 9 109623633 missense probably damaging 0.98
IGL01996:Fbxw24 APN 9 109605372 missense possibly damaging 0.84
IGL02179:Fbxw24 APN 9 109609905 nonsense probably null
IGL02718:Fbxw24 APN 9 109624790 missense possibly damaging 0.55
IGL02936:Fbxw24 APN 9 109624958 splice site probably null
IGL03010:Fbxw24 APN 9 109623610 missense probably benign 0.07
IGL03350:Fbxw24 APN 9 109607013 missense probably damaging 1.00
IGL03402:Fbxw24 APN 9 109601248 missense probably damaging 1.00
R0140:Fbxw24 UTSW 9 109605414 missense possibly damaging 0.73
R0718:Fbxw24 UTSW 9 109623509 splice site probably benign
R1166:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R1550:Fbxw24 UTSW 9 109607044 missense probably benign 0.00
R1950:Fbxw24 UTSW 9 109605413 missense probably benign 0.02
R1986:Fbxw24 UTSW 9 109607056 missense probably damaging 0.97
R2244:Fbxw24 UTSW 9 109605049 missense possibly damaging 0.66
R3683:Fbxw24 UTSW 9 109608042 missense possibly damaging 0.51
R4387:Fbxw24 UTSW 9 109609985 missense probably damaging 1.00
R4409:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4410:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4803:Fbxw24 UTSW 9 109624842 missense probably benign 0.02
R5571:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R6042:Fbxw24 UTSW 9 109607011 missense probably benign 0.09
R6523:Fbxw24 UTSW 9 109604980 nonsense probably null
R6799:Fbxw24 UTSW 9 109624930 missense probably damaging 1.00
R7122:Fbxw24 UTSW 9 109601260 missense probably benign 0.03
R7239:Fbxw24 UTSW 9 109605530 missense possibly damaging 0.71
R7405:Fbxw24 UTSW 9 109607068 missense possibly damaging 0.46
R7705:Fbxw24 UTSW 9 109608448 intron probably null
Predicted Primers PCR Primer
(F):5'- TCCGAAGAACTAGCAATTCTTTCTT -3'
(R):5'- TCTGACATTGACTCCAGCCTA -3'

Sequencing Primer
(F):5'- CAGGAGGTGACCTTGAACTTC -3'
(R):5'- ACTCACCTTTGGATGTTCTTTGAAG -3'
Posted On2015-06-24