Incidental Mutation 'R4324:Pcbp3'
ID323969
Institutional Source Beutler Lab
Gene Symbol Pcbp3
Ensembl Gene ENSMUSG00000001120
Gene Namepoly(rC) binding protein 3
SynonymsAlphaCP-3
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76761857-76961887 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 76763343 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 109 (R109*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001148] [ENSMUST00000092393] [ENSMUST00000105411] [ENSMUST00000168465]
Predicted Effect probably null
Transcript: ENSMUST00000001148
AA Change: R320*
SMART Domains Protein: ENSMUSP00000001148
Gene: ENSMUSG00000001120
AA Change: R320*

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 292 362 1.77e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092393
SMART Domains Protein: ENSMUSP00000090048
Gene: ENSMUSG00000001120

DomainStartEndE-ValueType
KH 12 80 4.66e-17 SMART
KH 96 167 2.08e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105411
AA Change: R319*
SMART Domains Protein: ENSMUSP00000101051
Gene: ENSMUSG00000001120
AA Change: R319*

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 291 361 1.77e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168240
Predicted Effect probably null
Transcript: ENSMUST00000168465
AA Change: R320*
SMART Domains Protein: ENSMUSP00000129465
Gene: ENSMUSG00000001120
AA Change: R320*

DomainStartEndE-ValueType
KH 44 112 4.66e-17 SMART
KH 128 199 2.08e-14 SMART
KH 292 362 1.77e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168505
Predicted Effect probably null
Transcript: ENSMUST00000173854
AA Change: R109*
SMART Domains Protein: ENSMUSP00000134144
Gene: ENSMUSG00000001120
AA Change: R109*

DomainStartEndE-ValueType
Blast:KH 8 63 4e-27 BLAST
KH 82 152 1.77e-17 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KH-domain protein subfamily. Proteins of this subfamily, also referred to as alpha-CPs, bind to RNA with a specificity for C-rich pyrimidine regions. Alpha-CPs play important roles in post-transcriptional activities and have different cellular distributions. The protein encoded by this gene lacks the nuclear localization signals found in other subfamily members. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Pcbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Pcbp3 APN 10 76767857 splice site probably benign
R1294:Pcbp3 UTSW 10 76763321 missense probably damaging 1.00
R2101:Pcbp3 UTSW 10 76789755 missense possibly damaging 0.71
R4675:Pcbp3 UTSW 10 76771035 missense possibly damaging 0.94
R6129:Pcbp3 UTSW 10 76763348 missense probably damaging 0.98
Z1088:Pcbp3 UTSW 10 76763323 missense probably benign 0.25
Z1177:Pcbp3 UTSW 10 76762514 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCTACTGTATCAGTCAGGCTGTG -3'
(R):5'- GACTTTGCAGTGCCTGAGTTC -3'

Sequencing Primer
(F):5'- GGGGCTGCGAGTCATAGCTAG -3'
(R):5'- TCCAGAGCGCTGAGTTCATAG -3'
Posted On2015-06-24