Incidental Mutation 'R4324:Stac3'
ID323970
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene NameSH3 and cysteine rich domain 3
Synonyms
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127501686-127508823 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127503249 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 76 (P76S)
Ref Sequence ENSEMBL: ENSMUSP00000125124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000160019] [ENSMUST00000160610] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000166820] [ENSMUST00000170336] [ENSMUST00000169888]
Predicted Effect probably damaging
Transcript: ENSMUST00000035839
AA Change: P76S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287
AA Change: P76S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064793
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160019
AA Change: P76S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287
AA Change: P76S

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164831
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166820
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171426
Predicted Effect probably benign
Transcript: ENSMUST00000170336
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127503664 missense probably damaging 1.00
IGL02271:Stac3 APN 10 127503899 missense probably benign 0.00
R0051:Stac3 UTSW 10 127508148 missense probably damaging 0.98
R0090:Stac3 UTSW 10 127503930 unclassified probably benign
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0131:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0132:Stac3 UTSW 10 127503650 missense probably damaging 0.97
R0330:Stac3 UTSW 10 127507747 splice site probably null
R0630:Stac3 UTSW 10 127507763 missense probably damaging 1.00
R1132:Stac3 UTSW 10 127507259 missense probably benign
R1450:Stac3 UTSW 10 127504885 missense probably damaging 1.00
R1739:Stac3 UTSW 10 127507766 missense probably benign 0.40
R2316:Stac3 UTSW 10 127503360 splice site probably null
R2511:Stac3 UTSW 10 127503918 critical splice donor site probably null
R3000:Stac3 UTSW 10 127508147 missense probably benign 0.01
R4758:Stac3 UTSW 10 127503345 missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127508124 missense probably damaging 0.98
R6244:Stac3 UTSW 10 127508175 missense probably damaging 1.00
R6275:Stac3 UTSW 10 127507746 nonsense probably null
R7335:Stac3 UTSW 10 127504900 missense probably benign 0.22
R8191:Stac3 UTSW 10 127508199 missense probably damaging 1.00
R8290:Stac3 UTSW 10 127503360 splice site probably null
R8410:Stac3 UTSW 10 127503330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCCATGATTGGAAAATGAGACC -3'
(R):5'- ACAGACACACCTCTCCTTGG -3'

Sequencing Primer
(F):5'- GACCATGACTGTCATTTAATGATGGG -3'
(R):5'- GACACACCTCTCCTTGGTCCTG -3'
Posted On2015-06-24