Incidental Mutation 'R4324:Wipi1'
ID323971
Institutional Source Beutler Lab
Gene Symbol Wipi1
Ensembl Gene ENSMUSG00000041895
Gene NameWD repeat domain, phosphoinositide interacting 1
Synonyms4930533H01Rik, D11Ertd498e
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock #R4324 (G1)
Quality Score202
Status Not validated
Chromosome11
Chromosomal Location109573331-109611967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109603836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 57 (I57N)
Ref Sequence ENSEMBL: ENSMUSP00000102300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047186] [ENSMUST00000103060] [ENSMUST00000106689]
Predicted Effect probably benign
Transcript: ENSMUST00000047186
AA Change: I57N

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038635
Gene: ENSMUSG00000041895
AA Change: I57N

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 7e-12 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
WD40 306 342 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103060
AA Change: I57N

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099349
Gene: ENSMUSG00000041895
AA Change: I57N

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 6e-12 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
WD40 306 342 4.93e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106689
AA Change: I57N

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102300
Gene: ENSMUSG00000041895
AA Change: I57N

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
Blast:WD40 90 125 2e-11 BLAST
Blast:WD40 128 172 1e-6 BLAST
WD40 175 215 3.45e-3 SMART
WD40 218 260 4.13e0 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD40 repeat protein. Members of the WD40 repeat family are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Other mutations in Wipi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Wipi1 APN 11 109583119 splice site probably benign
IGL02431:Wipi1 APN 11 109603791 missense probably damaging 1.00
R0082:Wipi1 UTSW 11 109578284 unclassified probably benign
R0400:Wipi1 UTSW 11 109577130 missense probably damaging 1.00
R1420:Wipi1 UTSW 11 109578372 missense probably benign 0.34
R2029:Wipi1 UTSW 11 109583190 missense probably damaging 1.00
R2077:Wipi1 UTSW 11 109577664 missense probably benign 0.04
R4928:Wipi1 UTSW 11 109579649 missense probably benign 0.04
R6964:Wipi1 UTSW 11 109603764 missense probably benign 0.15
R7283:Wipi1 UTSW 11 109611311 start codon destroyed probably null 0.23
R7720:Wipi1 UTSW 11 109582423 missense probably damaging 1.00
R7739:Wipi1 UTSW 11 109579709 missense probably damaging 1.00
Z1177:Wipi1 UTSW 11 109597198 missense probably damaging 1.00
Z1177:Wipi1 UTSW 11 109603801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAATTAACAGAAGGCTGGACATC -3'
(R):5'- ACAGTTAAAGCCTGTTGTTGGG -3'

Sequencing Primer
(F):5'- TTAACAGAAGGCTGGACATCTTGTG -3'
(R):5'- TTGGGGCCAGGATGGGAC -3'
Posted On2015-06-24