Incidental Mutation 'R4324:Uqcrfs1'
ID323974
Institutional Source Beutler Lab
Gene Symbol Uqcrfs1
Ensembl Gene ENSMUSG00000038462
Gene Nameubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms4430402G14Rik
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location30540308-30545362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30541158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000045284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042834]
Predicted Effect probably benign
Transcript: ENSMUST00000042834
AA Change: V133A

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045284
Gene: ENSMUSG00000038462
AA Change: V133A

DomainStartEndE-ValueType
Pfam:Ubiq-Cytc-red_N 2 77 6.4e-30 PFAM
Pfam:UCR_TM 80 145 1.3e-33 PFAM
Pfam:Rieske 176 268 5.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant mice harboring a 3' UTR insertion that reduces expression specifically in skin acquire dark patches in the dorsal brown coat at 4-7 months of age. In heterozygotes, the dark patches eventually fill the entire dorsal region; in homozygotes, the dark patches eventually turn grey. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Uqcrfs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Uqcrfs1 APN 13 30540925 missense probably benign 0.14
IGL01318:Uqcrfs1 APN 13 30540921 missense probably benign 0.15
IGL01603:Uqcrfs1 APN 13 30541198 missense probably benign
IGL02016:Uqcrfs1 APN 13 30545114 missense probably benign
IGL02740:Uqcrfs1 APN 13 30541023 missense probably damaging 1.00
R0142:Uqcrfs1 UTSW 13 30540942 missense probably benign 0.26
R0266:Uqcrfs1 UTSW 13 30541163 missense probably benign 0.17
R1457:Uqcrfs1 UTSW 13 30540907 missense probably damaging 1.00
R1469:Uqcrfs1 UTSW 13 30540801 missense probably damaging 1.00
R1469:Uqcrfs1 UTSW 13 30540801 missense probably damaging 1.00
R2079:Uqcrfs1 UTSW 13 30541308 missense probably benign 0.19
R2134:Uqcrfs1 UTSW 13 30540804 missense probably benign 0.22
R2262:Uqcrfs1 UTSW 13 30541107 missense probably benign 0.01
R2263:Uqcrfs1 UTSW 13 30541107 missense probably benign 0.01
R4963:Uqcrfs1 UTSW 13 30540763 missense probably damaging 1.00
R5783:Uqcrfs1 UTSW 13 30545204 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTTCCTGGTCAATCTC -3'
(R):5'- AATGTGTACCCTTTTCAAGACATCC -3'

Sequencing Primer
(F):5'- GGTCAATCTCCTTCTTGGTTCTATGG -3'
(R):5'- CAGTTCCTGCTTCTGTCCG -3'
Posted On2015-06-24