Incidental Mutation 'R4324:Trpc7'
ID323975
Institutional Source Beutler Lab
Gene Symbol Trpc7
Ensembl Gene ENSMUSG00000021541
Gene Nametransient receptor potential cation channel, subfamily C, member 7
SynonymsTrrp8, TRP7
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location56773113-56895993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56887356 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 255 (I255V)
Ref Sequence ENSEMBL: ENSMUSP00000133305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022023] [ENSMUST00000109871] [ENSMUST00000151918] [ENSMUST00000173817] [ENSMUST00000174457]
Predicted Effect probably benign
Transcript: ENSMUST00000022023
AA Change: I255V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022023
Gene: ENSMUSG00000021541
AA Change: I255V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 6e-28 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Pfam:Ion_trans 387 684 2.4e-34 PFAM
Pfam:PKD_channel 427 679 5.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109871
AA Change: I255V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105497
Gene: ENSMUSG00000021541
AA Change: I255V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 1.1e-31 PFAM
transmembrane domain 352 374 N/A INTRINSIC
transmembrane domain 389 406 N/A INTRINSIC
Pfam:PKD_channel 427 679 1.6e-13 PFAM
Pfam:Ion_trans 441 672 7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151918
AA Change: I255V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119809
Gene: ENSMUSG00000021541
AA Change: I255V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 4.6e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173067
AA Change: I254V
SMART Domains Protein: ENSMUSP00000134481
Gene: ENSMUSG00000021541
AA Change: I254V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 5.1e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173466
AA Change: I254V
SMART Domains Protein: ENSMUSP00000134285
Gene: ENSMUSG00000021541
AA Change: I254V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 9.5e-32 PFAM
transmembrane domain 352 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173513
AA Change: I254V
SMART Domains Protein: ENSMUSP00000134662
Gene: ENSMUSG00000021541
AA Change: I254V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.5e-31 PFAM
Pfam:PKD_channel 311 563 2.6e-13 PFAM
Pfam:Ion_trans 325 556 1.1e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173817
AA Change: I255V

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133411
Gene: ENSMUSG00000021541
AA Change: I255V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
transmembrane domain 291 313 N/A INTRINSIC
transmembrane domain 328 345 N/A INTRINSIC
Pfam:PKD_channel 366 618 3.7e-13 PFAM
Pfam:Ion_trans 380 611 1.2e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174457
AA Change: I255V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133305
Gene: ENSMUSG00000021541
AA Change: I255V

DomainStartEndE-ValueType
ANK 42 71 1.53e3 SMART
ANK 77 105 1.97e1 SMART
ANK 163 192 1.32e0 SMART
Pfam:TRP_2 198 260 2.7e-31 PFAM
Pfam:PKD_channel 372 624 3.8e-13 PFAM
Pfam:Ion_trans 386 617 1.3e-35 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the transient receptor potential channel family of proteins, which form six-transmembrane cation-permeable channels that are calcium permeant. Knock out mice are viable but display a reduction in the gamma wave activity that precedes seizure induction in response to a muscrarinic agonist, suggesting a functional role for this protein in initiation of seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Trpc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Trpc7 APN 13 56773809 missense possibly damaging 0.64
IGL00809:Trpc7 APN 13 56822488 missense probably benign 0.00
IGL01011:Trpc7 APN 13 56804540 missense probably damaging 1.00
IGL01517:Trpc7 APN 13 56861065 missense probably damaging 1.00
IGL01824:Trpc7 APN 13 56789722 nonsense probably null
IGL02055:Trpc7 APN 13 56887544 missense probably benign 0.13
IGL02267:Trpc7 APN 13 56860930 missense probably damaging 1.00
IGL02323:Trpc7 APN 13 56783751 missense possibly damaging 0.91
IGL02451:Trpc7 APN 13 56822461 missense probably damaging 0.98
IGL02635:Trpc7 APN 13 56776168 missense probably damaging 1.00
IGL03335:Trpc7 APN 13 56887691 missense probably damaging 1.00
PIT4305001:Trpc7 UTSW 13 56887508 missense probably benign 0.00
R0217:Trpc7 UTSW 13 56789768 nonsense probably null
R0611:Trpc7 UTSW 13 56887823 missense probably damaging 1.00
R0919:Trpc7 UTSW 13 56822649 splice site probably benign
R1235:Trpc7 UTSW 13 56887539 missense probably damaging 1.00
R1751:Trpc7 UTSW 13 56776143 missense probably damaging 1.00
R4649:Trpc7 UTSW 13 56887554 missense probably damaging 1.00
R4731:Trpc7 UTSW 13 56804553 missense probably damaging 1.00
R5379:Trpc7 UTSW 13 56804550 missense probably damaging 1.00
R5834:Trpc7 UTSW 13 56776158 missense probably damaging 1.00
R5985:Trpc7 UTSW 13 56810545 missense probably damaging 0.96
R6244:Trpc7 UTSW 13 56773892 missense probably damaging 1.00
R6599:Trpc7 UTSW 13 56810380 splice site probably null
R6778:Trpc7 UTSW 13 56804687 missense probably damaging 1.00
R7140:Trpc7 UTSW 13 56789674 nonsense probably null
R7150:Trpc7 UTSW 13 56783696 missense probably benign 0.00
R7156:Trpc7 UTSW 13 56789766 missense possibly damaging 0.61
R7238:Trpc7 UTSW 13 56826897 missense probably benign 0.17
R7716:Trpc7 UTSW 13 56789760 missense probably damaging 1.00
R7739:Trpc7 UTSW 13 56773766 makesense probably null
R8114:Trpc7 UTSW 13 56804598 missense probably benign 0.14
R8143:Trpc7 UTSW 13 56782549 missense probably benign 0.01
R8179:Trpc7 UTSW 13 56887880 missense probably damaging 1.00
R8204:Trpc7 UTSW 13 56783796 missense probably benign 0.06
R8262:Trpc7 UTSW 13 56789789 missense probably benign 0.32
R8325:Trpc7 UTSW 13 56804711 missense probably damaging 1.00
R8353:Trpc7 UTSW 13 56822559 missense probably benign 0.04
R8414:Trpc7 UTSW 13 56822469 missense probably benign 0.01
R8453:Trpc7 UTSW 13 56822559 missense probably benign 0.04
Z1177:Trpc7 UTSW 13 56810444 missense probably benign 0.00
Z1177:Trpc7 UTSW 13 56822432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACATCCCAGTTCTAGGCTGC -3'
(R):5'- CATGACTACTTCTGCAAGTGC -3'

Sequencing Primer
(F):5'- GGTCTACACACGACAAATTATCGCG -3'
(R):5'- CAATGAGTGCACGGAGAAGC -3'
Posted On2015-06-24