Incidental Mutation 'R4324:Atg10'
ID323976
Institutional Source Beutler Lab
Gene Symbol Atg10
Ensembl Gene ENSMUSG00000021619
Gene Nameautophagy related 10
Synonyms5330424L23Rik, 5430428K15Rik, APG10, Apg10l, Apg10p
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90935356-91223968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91040966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 75 (D75V)
Ref Sequence ENSEMBL: ENSMUSP00000022119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022119] [ENSMUST00000224449]
Predicted Effect probably damaging
Transcript: ENSMUST00000022119
AA Change: D75V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022119
Gene: ENSMUSG00000021619
AA Change: D75V

DomainStartEndE-ValueType
Pfam:Autophagy_act_C 95 162 9.1e-19 PFAM
low complexity region 188 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223729
Predicted Effect probably benign
Transcript: ENSMUST00000224449
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes. ATG10 is an E2-like enzyme involved in 2 ubiquitin-like modifications essential for autophagosome formation: ATG12 (MIM 609608)-ATG5 (MIM 604261) conjugation and modification of a soluble form of MAP-LC3 (MAP1LC3A; MIM 601242), a homolog of yeast Apg8, to a membrane-bound form (Nemoto et al., 2003 [PubMed 12890687]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Atg10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Atg10 APN 13 91154211 splice site probably benign
IGL03131:Atg10 APN 13 90937293 missense probably null 0.99
R0362:Atg10 UTSW 13 91040990 critical splice acceptor site probably null
R0826:Atg10 UTSW 13 90936586 critical splice donor site probably null
R1593:Atg10 UTSW 13 91154261 missense probably benign 0.02
R2918:Atg10 UTSW 13 91040908 missense probably damaging 1.00
R3012:Atg10 UTSW 13 91154278 missense probably damaging 0.99
R3036:Atg10 UTSW 13 91040898 missense probably damaging 1.00
R3837:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3838:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R3839:Atg10 UTSW 13 90937380 missense probably damaging 1.00
R6195:Atg10 UTSW 13 91208436 splice site probably null
R6478:Atg10 UTSW 13 90937347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCCTCTCAGGAATGA -3'
(R):5'- GTGTGGGTAGCTCTCCCT -3'

Sequencing Primer
(F):5'- CAAATATGCTCCCTGTCTTATATGG -3'
(R):5'- GTGGGTAGCTCTCCCTTTTCTTAC -3'
Posted On2015-06-24