Incidental Mutation 'R4324:Enc1'
ID323977
Institutional Source Beutler Lab
Gene Symbol Enc1
Ensembl Gene ENSMUSG00000041773
Gene Nameectodermal-neural cortex 1
SynonymsNrpb, PIG10
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97241105-97253034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97245897 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 305 (F305S)
Ref Sequence ENSEMBL: ENSMUSP00000038783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041623]
Predicted Effect probably benign
Transcript: ENSMUST00000041623
AA Change: F305S

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038783
Gene: ENSMUSG00000041773
AA Change: F305S

DomainStartEndE-ValueType
BTB 46 144 8.4e-32 SMART
BACK 149 251 7.5e-33 SMART
Kelch 296 340 3.89e0 SMART
Kelch 341 388 2.69e-9 SMART
Kelch 389 444 7.77e-15 SMART
Kelch 445 492 1.97e0 SMART
Kelch 493 538 2.9e-1 SMART
Kelch 539 585 1.5e-7 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-related family of actin-binding proteins. The encoded protein plays a role in the oxidative stress response as a regulator of the transcription factor Nrf2, and expression of this gene may play a role in malignant transformation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Enc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Enc1 APN 13 97245314 missense probably benign 0.00
IGL02010:Enc1 APN 13 97245080 missense possibly damaging 0.84
IGL02642:Enc1 APN 13 97245534 missense possibly damaging 0.84
IGL03342:Enc1 APN 13 97246470 missense possibly damaging 0.64
R1305:Enc1 UTSW 13 97246700 missense possibly damaging 0.58
R1419:Enc1 UTSW 13 97246184 missense probably damaging 1.00
R1733:Enc1 UTSW 13 97245042 missense possibly damaging 0.63
R1796:Enc1 UTSW 13 97246483 missense probably benign 0.00
R1796:Enc1 UTSW 13 97246485 missense possibly damaging 0.58
R1823:Enc1 UTSW 13 97245978 missense possibly damaging 0.64
R4107:Enc1 UTSW 13 97245138 missense probably damaging 1.00
R4922:Enc1 UTSW 13 97245735 missense probably benign 0.08
R5942:Enc1 UTSW 13 97246379 missense probably benign 0.28
R5951:Enc1 UTSW 13 97245257 missense probably benign 0.02
R6229:Enc1 UTSW 13 97245491 missense probably benign
R6985:Enc1 UTSW 13 97245120 missense possibly damaging 0.92
R6987:Enc1 UTSW 13 97245636 missense probably benign 0.14
R7307:Enc1 UTSW 13 97245093 missense probably damaging 1.00
R7442:Enc1 UTSW 13 97246740 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTACCTCCCGGAACTGTTGC -3'
(R):5'- CGTAAACCCAGACATCTTTTGAG -3'

Sequencing Primer
(F):5'- CCATCTATCTCATGGAGAACGTGG -3'
(R):5'- ACCCAGACATCTTTTGAGACTCCG -3'
Posted On2015-06-24