Incidental Mutation 'R4324:Krt82'
ID323979
Institutional Source Beutler Lab
Gene Symbol Krt82
Ensembl Gene ENSMUSG00000049548
Gene Namekeratin 82
SynonymsKrt2-20
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101541214-101550667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101541747 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 505 (M505L)
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713]
Predicted Effect probably benign
Transcript: ENSMUST00000023713
AA Change: M505L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: M505L

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Krt82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Krt82 APN 15 101543378 missense probably damaging 0.97
IGL01112:Krt82 APN 15 101545523 missense probably damaging 1.00
IGL01820:Krt82 APN 15 101543452 splice site probably benign
IGL02529:Krt82 APN 15 101550396 nonsense probably null
IGL02894:Krt82 APN 15 101542720 missense probably damaging 1.00
IGL02974:Krt82 APN 15 101550585 nonsense probably null
IGL03263:Krt82 APN 15 101541872 missense probably benign 0.00
R0268:Krt82 UTSW 15 101541713 missense probably benign 0.02
R0385:Krt82 UTSW 15 101545593 missense probably damaging 1.00
R0542:Krt82 UTSW 15 101545600 splice site probably benign
R1073:Krt82 UTSW 15 101550254 missense probably damaging 1.00
R1601:Krt82 UTSW 15 101545153 missense probably damaging 1.00
R1795:Krt82 UTSW 15 101543384 missense possibly damaging 0.90
R1944:Krt82 UTSW 15 101548535 missense probably damaging 1.00
R1974:Krt82 UTSW 15 101545162 missense probably benign 0.00
R2049:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2140:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2851:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2852:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2853:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R3815:Krt82 UTSW 15 101550600 missense probably damaging 1.00
R4798:Krt82 UTSW 15 101550488 missense probably benign 0.01
R4980:Krt82 UTSW 15 101545099 missense possibly damaging 0.85
R5212:Krt82 UTSW 15 101545049 missense probably damaging 1.00
R5260:Krt82 UTSW 15 101548388 missense possibly damaging 0.88
R5821:Krt82 UTSW 15 101548385 nonsense probably null
R6009:Krt82 UTSW 15 101545105 missense probably benign 0.00
R6955:Krt82 UTSW 15 101542849 missense probably damaging 1.00
R7194:Krt82 UTSW 15 101542756 missense probably damaging 1.00
R7307:Krt82 UTSW 15 101542907 missense probably damaging 0.97
R7420:Krt82 UTSW 15 101545587 missense probably damaging 0.96
R7837:Krt82 UTSW 15 101548357 missense possibly damaging 0.86
R8354:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8371:Krt82 UTSW 15 101545111 missense probably benign 0.12
R8454:Krt82 UTSW 15 101541803 missense probably damaging 1.00
Z1176:Krt82 UTSW 15 101541852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGATATGCGAAGGGTGGC -3'
(R):5'- CTCCAAAGGTGCCGTACTCTAC -3'

Sequencing Primer
(F):5'- TGGCTTTGAAGAAATGAGCG -3'
(R):5'- ACTCTACGAGCCCTGTGTGATG -3'
Posted On2015-06-24