Incidental Mutation 'R4324:Spag6l'
ID323980
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Namesperm associated antigen 6-like
SynonymsPF16, Spag6
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16753016-16829456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16787235 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
Predicted Effect probably benign
Transcript: ENSMUST00000023468
AA Change: Y151C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: Y151C

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16780733 missense probably benign 0.20
IGL00928:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16781857 missense probably damaging 1.00
IGL02380:Spag6l APN 16 16763169 critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16780728 missense probably damaging 1.00
R0284:Spag6l UTSW 16 16780766 missense probably damaging 0.99
R0394:Spag6l UTSW 16 16780629 missense probably benign
R0720:Spag6l UTSW 16 16767096 splice site probably benign
R1205:Spag6l UTSW 16 16787307 missense probably damaging 1.00
R1496:Spag6l UTSW 16 16780614 splice site probably benign
R1707:Spag6l UTSW 16 16780628 missense probably benign 0.00
R1926:Spag6l UTSW 16 16763057 missense probably benign 0.00
R2255:Spag6l UTSW 16 16777339 missense probably damaging 0.96
R2330:Spag6l UTSW 16 16829085 missense probably benign
R3755:Spag6l UTSW 16 16763020 critical splice donor site probably null
R3796:Spag6l UTSW 16 16763052 missense probably damaging 1.00
R4093:Spag6l UTSW 16 16829024 missense probably benign 0.05
R4725:Spag6l UTSW 16 16792531 missense probably damaging 1.00
R4766:Spag6l UTSW 16 16777390 missense probably benign 0.03
R4877:Spag6l UTSW 16 16781758 missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16766967 critical splice donor site probably null
R5958:Spag6l UTSW 16 16763021 critical splice donor site probably null
R6107:Spag6l UTSW 16 16781788 missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16783938 missense probably damaging 1.00
R7329:Spag6l UTSW 16 16767019 missense probably benign
R7634:Spag6l UTSW 16 16777414 missense probably damaging 0.97
R8240:Spag6l UTSW 16 16763025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTTGAGGACCAATCC -3'
(R):5'- CCAGGTTCATTGAGCTCTCTTTAAAG -3'

Sequencing Primer
(F):5'- TCCCACTCCAAATAGCTGGACTG -3'
(R):5'- GTTCTGTTCTTTTCCCTGTTAGCG -3'
Posted On2015-06-24