Incidental Mutation 'R4324:Ccdc191'
ID323981
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Namecoiled-coil domain containing 191
Synonyms2610015P09Rik
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location43889800-43964314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43947509 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000116078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
Predicted Effect probably damaging
Transcript: ENSMUST00000122440
AA Change: E267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: E267G

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: E624G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: E624G

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145999
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: E682G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: E682G

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R7843:Ccdc191 UTSW 16 43959336 missense probably damaging 1.00
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCTTCCTGTCACAAAAGGC -3'
(R):5'- CCCAGCATCTCTGAAATGTATTTTC -3'

Sequencing Primer
(F):5'- ACAGGCATTTGGTAGATACTTTGC -3'
(R):5'- GAAATGTATTTTCTTCTGTCCATCGC -3'
Posted On2015-06-24