Incidental Mutation 'R4324:H2-K1'
ID323982
Institutional Source Beutler Lab
Gene Symbol H2-K1
Ensembl Gene ENSMUSG00000061232
Gene Namehistocompatibility 2, K1, K region
SynonymsH-2K
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4324 (G1)
Quality Score191
Status Not validated
Chromosome17
Chromosomal Location33996017-34000333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34000040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 30 (V30M)
Ref Sequence ENSEMBL: ENSMUSP00000133847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025181] [ENSMUST00000087189] [ENSMUST00000172912] [ENSMUST00000173075]
Predicted Effect probably benign
Transcript: ENSMUST00000025181
SMART Domains Protein: ENSMUSP00000025181
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 1.4e-95 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 335 359 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087189
SMART Domains Protein: ENSMUSP00000084436
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
IGc1 37 108 9.98e-22 SMART
low complexity region 124 143 N/A INTRINSIC
Pfam:MHC_I_C 152 177 5.9e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172782
Predicted Effect probably benign
Transcript: ENSMUST00000172912
SMART Domains Protein: ENSMUSP00000134004
Gene: ENSMUSG00000061232

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 22 200 6.7e-97 PFAM
IGc1 219 290 9.98e-22 SMART
transmembrane domain 306 328 N/A INTRINSIC
Pfam:MHC_I_C 334 359 9.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173075
AA Change: V30M

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133847
Gene: ENSMUSG00000061232
AA Change: V30M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 42 220 3.7e-97 PFAM
Pfam:C1-set 229 289 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173602
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display T-cell abnormalities and abnormal susceptibility to various viral infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rnf125 G A 18: 20,977,760 R25K probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in H2-K1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:H2-K1 APN 17 33999492 missense probably damaging 1.00
FR4548:H2-K1 UTSW 17 33997042 unclassified probably benign
FR4976:H2-K1 UTSW 17 33997042 unclassified probably benign
R0254:H2-K1 UTSW 17 33996665 unclassified probably benign
R0520:H2-K1 UTSW 17 33997416 missense probably damaging 1.00
R0540:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R0607:H2-K1 UTSW 17 33999500 missense probably damaging 1.00
R1282:H2-K1 UTSW 17 33999447 missense probably damaging 1.00
R1785:H2-K1 UTSW 17 33997348 nonsense probably null
R2307:H2-K1 UTSW 17 33997139 missense probably benign 0.26
R3791:H2-K1 UTSW 17 33999525 missense probably benign 0.02
R3847:H2-K1 UTSW 17 33997329 missense probably damaging 1.00
R4008:H2-K1 UTSW 17 33999551 splice site probably benign
R4470:H2-K1 UTSW 17 34000061 missense probably benign 0.20
R4543:H2-K1 UTSW 17 33999558 splice site probably null
R4858:H2-K1 UTSW 17 33997324 missense probably benign 0.05
R4921:H2-K1 UTSW 17 33997076 missense possibly damaging 0.65
R5254:H2-K1 UTSW 17 33997462 missense probably damaging 1.00
R5269:H2-K1 UTSW 17 33997015 unclassified probably benign
R6058:H2-K1 UTSW 17 33999330 missense probably benign 0.02
R6058:H2-K1 UTSW 17 33999331 missense probably benign
R7941:H2-K1 UTSW 17 33999331 missense probably benign
R8057:H2-K1 UTSW 17 33996859 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCGGCTCATATCTCGGATTC -3'
(R):5'- CAGAACTCAGAAGTCGCGAATCG -3'

Sequencing Primer
(F):5'- GATTCTCCGCGTCGCTG -3'
(R):5'- TGCGATGGTACCGTGCAC -3'
Posted On2015-06-24