Incidental Mutation 'R4324:Rnf125'
ID323984
Institutional Source Beutler Lab
Gene Symbol Rnf125
Ensembl Gene ENSMUSG00000033107
Gene Namering finger protein 125
Synonyms
MMRRC Submission 041095-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4324 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20944625-20983848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 20977760 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 25 (R25K)
Ref Sequence ENSEMBL: ENSMUSP00000058251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050004]
Predicted Effect probably benign
Transcript: ENSMUST00000050004
AA Change: R25K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058251
Gene: ENSMUSG00000033107
AA Change: R25K

DomainStartEndE-ValueType
ZnF_C2H2 47 68 7.18e1 SMART
ZnF_C2H2 76 104 5.68e1 SMART
low complexity region 109 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Alg9 T G 9: 50,805,343 H22Q probably damaging Het
Aqp6 G A 15: 99,601,410 M1I probably null Het
Arhgef10 T A 8: 14,940,335 I270N possibly damaging Het
Asb13 G T 13: 3,645,012 R160L possibly damaging Het
Atg10 T A 13: 91,040,966 D75V probably damaging Het
Atxn7l2 A T 3: 108,205,832 D218E probably damaging Het
Ccdc191 A G 16: 43,947,509 E624G probably damaging Het
Cdan1 T C 2: 120,724,979 I760M probably damaging Het
Cdk14 T A 5: 5,036,532 K263* probably null Het
Cdk5rap2 A T 4: 70,353,614 I287N probably damaging Het
Cdkn2aip A T 8: 47,712,173 S168R probably benign Het
Dnah17 C T 11: 118,094,213 V1555M probably benign Het
Dsel T C 1: 111,861,393 T471A probably damaging Het
Dzank1 T C 2: 144,488,698 E478G possibly damaging Het
Enc1 T C 13: 97,245,897 F305S probably benign Het
Epn1 T A 7: 5,097,211 M441K probably benign Het
Fbxw24 C T 9: 109,604,945 probably null Het
Gad1 G A 2: 70,589,830 D353N probably damaging Het
Ggcx A G 6: 72,428,820 S545G probably benign Het
H2-K1 C T 17: 34,000,040 V30M possibly damaging Het
Hipk3 C A 2: 104,446,571 V388L probably damaging Het
Krt82 T A 15: 101,541,747 M505L probably benign Het
Man2a1 A G 17: 64,666,793 I355V probably benign Het
Olfr473 C T 7: 107,933,693 P58S probably damaging Het
Pcbp3 G A 10: 76,763,343 R109* probably null Het
Pcgf1 T C 6: 83,079,957 probably null Het
Plekhm2 A T 4: 141,631,857 V533E possibly damaging Het
Prss3 T G 6: 41,373,845 D237A probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Shc4 T A 2: 125,678,750 M260L probably benign Het
Spag6l T C 16: 16,787,235 Y151C probably benign Het
Stac3 C T 10: 127,503,249 P76S probably damaging Het
Trpc7 T C 13: 56,887,356 I255V probably damaging Het
Ttn T C 2: 76,908,579 E3872G probably benign Het
Uqcrfs1 A G 13: 30,541,158 V133A probably benign Het
Vmn2r52 T A 7: 10,171,013 T300S possibly damaging Het
Wipi1 A T 11: 109,603,836 I57N possibly damaging Het
Other mutations in Rnf125
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Rnf125 APN 18 20983111 missense probably benign 0.08
R0631:Rnf125 UTSW 18 20979083 missense possibly damaging 0.85
R0980:Rnf125 UTSW 18 20979060 nonsense probably null
R1344:Rnf125 UTSW 18 20981231 missense possibly damaging 0.86
R1731:Rnf125 UTSW 18 20977816 missense probably benign
R3085:Rnf125 UTSW 18 20977730 missense probably benign 0.22
R4320:Rnf125 UTSW 18 20977760 missense probably benign 0.04
R4322:Rnf125 UTSW 18 20977760 missense probably benign 0.04
R7366:Rnf125 UTSW 18 20974433 missense not run
Predicted Primers PCR Primer
(F):5'- CACCACCAAAGTATAGGCATTATTC -3'
(R):5'- TTGAGTGGTTTCACATAGGAGTAC -3'

Sequencing Primer
(F):5'- CTTGATAAGGCCTGTACTTTGTGAC -3'
(R):5'- GTGGTTTCACATAGGAGTACCTCAC -3'
Posted On2015-06-24