Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Abl2'

323986

Institutional Source

Beutler Lab

Gene Symbol

Abl2

Ensembl Gene

ENSMUSG00000026596

Gene Name

v-abl Abelson murine leukemia viral oncogene 2 (arg, Abelson-related gene)

Synonyms

Abll, Arg

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.476) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

156558786-156649568 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 156641563 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 695 (M695K)

Ref Sequence

ENSEMBL: ENSMUSP00000126181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027888
AA Change: M799K

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: M799K

Domain	Start	End	E-Value	Type
low complexity region	20	40	N/A	INTRINSIC
SH3	110	166	9.83e-16	SMART
SH2	171	254	1.34e-33	SMART
TyrKc	288	539	2.53e-148	SMART
low complexity region	561	577	N/A	INTRINSIC
low complexity region	598	609	N/A	INTRINSIC
low complexity region	734	752	N/A	INTRINSIC
low complexity region	877	891	N/A	INTRINSIC
low complexity region	974	991	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
FABD	1061	1182	5.24e-65	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166172
AA Change: M695K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: M695K

Domain	Start	End	E-Value	Type
low complexity region	20	40	N/A	INTRINSIC
SH3	110	166	9.83e-16	SMART
SH2	171	254	1.34e-33	SMART
TyrKc	288	539	2.53e-148	SMART
low complexity region	561	577	N/A	INTRINSIC
low complexity region	598	609	N/A	INTRINSIC
low complexity region	773	787	N/A	INTRINSIC
low complexity region	870	887	N/A	INTRINSIC
low complexity region	932	945	N/A	INTRINSIC
FABD	957	1078	5.24e-65	SMART

Meta Mutation Damage Score

0.0651

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Abl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01400:Abl2	APN	1	156635184	missense	probably damaging	1.00
IGL01679:Abl2	APN	1	156642465	missense	probably benign	0.01
IGL02289:Abl2	APN	1	156629854	missense	probably damaging	1.00
PIT4495001:Abl2	UTSW	1	156633185	missense	probably damaging	1.00
R0907:Abl2	UTSW	1	156629859	missense	probably damaging	1.00
R1232:Abl2	UTSW	1	156641730	missense	probably damaging	1.00
R2069:Abl2	UTSW	1	156620827	splice site	probably null
R4224:Abl2	UTSW	1	156633847	missense	probably damaging	0.98
R4411:Abl2	UTSW	1	156630082	missense	possibly damaging	0.86
R4490:Abl2	UTSW	1	156633779	missense	probably damaging	1.00
R5132:Abl2	UTSW	1	156641832	nonsense	probably null
R5383:Abl2	UTSW	1	156642232	missense	possibly damaging	0.89
R5428:Abl2	UTSW	1	156642111	missense	probably damaging	1.00
R5436:Abl2	UTSW	1	156629880	missense	probably damaging	1.00
R5760:Abl2	UTSW	1	156641857	missense	probably benign	0.06
R6051:Abl2	UTSW	1	156642085	missense	probably damaging	1.00
R6955:Abl2	UTSW	1	156622649	missense	probably damaging	1.00
R7002:Abl2	UTSW	1	156559133	missense	probably damaging	1.00
R7038:Abl2	UTSW	1	156641409	missense	possibly damaging	0.95
R7172:Abl2	UTSW	1	156622587	missense	probably damaging	1.00
R7268:Abl2	UTSW	1	156633939	critical splice donor site	probably null
R7282:Abl2	UTSW	1	156630060	missense	probably damaging	1.00
R7303:Abl2	UTSW	1	156641250	missense	probably benign	0.00
R7372:Abl2	UTSW	1	156622619	missense	probably damaging	1.00
R7375:Abl2	UTSW	1	156622614	missense	probably damaging	1.00
R7443:Abl2	UTSW	1	156625381	missense	probably damaging	1.00
R7468:Abl2	UTSW	1	156622534	missense	possibly damaging	0.68
R7614:Abl2	UTSW	1	156636859	missense	possibly damaging	0.71
R7644:Abl2	UTSW	1	156615993	missense	probably benign	0.08
R7783:Abl2	UTSW	1	156559071	missense	probably benign
R8158:Abl2	UTSW	1	156642069	missense	probably benign	0.00
R8675:Abl2	UTSW	1	156625339	missense	probably damaging	1.00
R8930:Abl2	UTSW	1	156633832	missense	probably damaging	0.98
R8932:Abl2	UTSW	1	156633832	missense	probably damaging	0.98
R9217:Abl2	UTSW	1	156625332	missense	probably damaging	1.00
R9262:Abl2	UTSW	1	156642250	missense	possibly damaging	0.93
R9290:Abl2	UTSW	1	156629968	missense	probably damaging	1.00
X0067:Abl2	UTSW	1	156631433	splice site	probably null
Z1177:Abl2	UTSW	1	156641106	missense	probably damaging	1.00
Z1177:Abl2	UTSW	1	156641553	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGAACCTCTGTGCTGATGATG -3'
(R):5'- GCTCCTCTGGGCAATAGTTTGG -3'

Sequencing Primer
(F):5'- ACCTCTGTGCTGATGATGACAGTG -3'
(R):5'- GCAATAGTTTGGCTTTTGGTCTCTCC -3'

Posted On

2015-06-24