Incidental Mutation 'R4305:Mtch2'
ID 323989
Institutional Source Beutler Lab
Gene Symbol Mtch2
Ensembl Gene ENSMUSG00000027282
Gene Name mitochondrial carrier 2
Synonyms 2310034D24Rik, HSPC032, 4930539J07Rik
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90847155-90866810 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90859483 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 183 (I183V)
Ref Sequence ENSEMBL: ENSMUSP00000121851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111467] [ENSMUST00000111468] [ENSMUST00000136872] [ENSMUST00000150232]
AlphaFold Q791V5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057216
Predicted Effect probably benign
Transcript: ENSMUST00000111467
AA Change: I174V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107092
Gene: ENSMUSG00000027282
AA Change: I174V

DomainStartEndE-ValueType
Pfam:Mito_carr 109 198 1.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135026
Predicted Effect probably benign
Transcript: ENSMUST00000136872
AA Change: I183V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121851
Gene: ENSMUSG00000027282
AA Change: I183V

DomainStartEndE-ValueType
Pfam:Mito_carr 118 207 3.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144696
Predicted Effect probably benign
Transcript: ENSMUST00000150232
AA Change: I192V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118566
Gene: ENSMUSG00000027282
AA Change: I192V

DomainStartEndE-ValueType
Pfam:Mito_carr 127 215 1.7e-11 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: This gene encodes a member of the SLC25 family of nuclear-encoded transporters that are localized in the inner mitochondrial membrane. Members of this superfamily are involved in many metabolic pathways and cell functions. Genome-wide association studies in human have identified single-nucleotide polymorphisms in several loci associated with obesity. This gene is one such locus, which is highly expressed in white adipose tissue and adipocytes, and thought to play a regulatory role in adipocyte differentiation and biology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA can give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mesoderm development, disorganized extraembryonic tissue, lack of amnion and chorion formation, decreased embryo size, and lethality at around E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Mtch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03390:Mtch2 APN 2 90859550 missense probably benign 0.08
R0543:Mtch2 UTSW 2 90849682 missense possibly damaging 0.81
R0578:Mtch2 UTSW 2 90852830 splice site probably benign
R1418:Mtch2 UTSW 2 90853015 splice site probably benign
R1996:Mtch2 UTSW 2 90847321 missense possibly damaging 0.74
R6268:Mtch2 UTSW 2 90863648 missense probably benign
R6386:Mtch2 UTSW 2 90849395 missense probably benign 0.30
R8433:Mtch2 UTSW 2 90847161 unclassified probably benign
R8434:Mtch2 UTSW 2 90852864 nonsense probably null
R8864:Mtch2 UTSW 2 90854930 nonsense probably null
R9251:Mtch2 UTSW 2 90849636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTTTGGCCTTCCCTATTATGG -3'
(R):5'- ATGCCATCAGCCTTTGAAAAG -3'

Sequencing Primer
(F):5'- GGCTGTAGGTTATAGCTGAC -3'
(R):5'- AGCCCTCACCAGCATATT -3'
Posted On 2015-06-24