Incidental Mutation 'R4305:Olfr1281'
ID323990
Institutional Source Beutler Lab
Gene Symbol Olfr1281
Ensembl Gene ENSMUSG00000095156
Gene Nameolfactory receptor 1281
SynonymsGA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4305 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111326520-111332852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111329298 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 293 (D293G)
Ref Sequence ENSEMBL: ENSMUSP00000087798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090326] [ENSMUST00000208176] [ENSMUST00000213551]
Predicted Effect probably null
Transcript: ENSMUST00000090326
AA Change: D293G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087798
Gene: ENSMUSG00000095156
AA Change: D293G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 301 2.6e-6 PFAM
Pfam:7tm_1 41 287 4.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208176
AA Change: D293G

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000213551
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Olfr1281
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02426:Olfr1281 APN 2 111328575 missense probably damaging 1.00
IGL02550:Olfr1281 APN 2 111328500 missense probably damaging 1.00
IGL02553:Olfr1281 APN 2 111328988 missense probably benign
IGL02719:Olfr1281 APN 2 111329245 nonsense probably null
IGL02750:Olfr1281 APN 2 111329288 missense probably damaging 1.00
IGL02873:Olfr1281 APN 2 111328872 missense probably benign
IGL03252:Olfr1281 APN 2 111328780 nonsense probably null
IGL03375:Olfr1281 APN 2 111328884 missense probably damaging 1.00
R0055:Olfr1281 UTSW 2 111328525 nonsense probably null
R0368:Olfr1281 UTSW 2 111328787 missense probably damaging 0.99
R0497:Olfr1281 UTSW 2 111328830 missense probably benign 0.00
R0505:Olfr1281 UTSW 2 111329328 missense probably benign 0.00
R1557:Olfr1281 UTSW 2 111328619 missense probably damaging 1.00
R1619:Olfr1281 UTSW 2 111328961 missense probably benign 0.02
R1691:Olfr1281 UTSW 2 111328853 missense probably benign 0.03
R2286:Olfr1281 UTSW 2 111328907 missense probably benign 0.01
R4230:Olfr1281 UTSW 2 111329130 missense probably damaging 1.00
R4274:Olfr1281 UTSW 2 111328815 missense probably damaging 0.98
R4495:Olfr1281 UTSW 2 111329020 missense probably benign 0.08
R5307:Olfr1281 UTSW 2 111328396 splice site probably null
R6115:Olfr1281 UTSW 2 111329213 missense probably benign 0.03
R6615:Olfr1281 UTSW 2 111329112 missense probably benign 0.00
R7169:Olfr1281 UTSW 2 111328598 missense probably damaging 1.00
R7601:Olfr1281 UTSW 2 111329220 missense probably benign 0.12
R8267:Olfr1281 UTSW 2 111328815 missense probably benign 0.22
R8447:Olfr1281 UTSW 2 111328962 missense possibly damaging 0.81
Z1177:Olfr1281 UTSW 2 111328825 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATGGCTCATCAAAAGCACTATC -3'
(R):5'- ACCGTGTACAGATAAAACTACTAGC -3'

Sequencing Primer
(F):5'- CCACATGCACATCCCATATCATAGTG -3'
(R):5'- GCAGCAAATTAGAATTAAGATTGGC -3'
Posted On2015-06-24