Incidental Mutation 'R4305:Zdhhc4'
ID 323993
Institutional Source Beutler Lab
Gene Symbol Zdhhc4
Ensembl Gene ENSMUSG00000001844
Gene Name zinc finger, DHHC domain containing 4
Synonyms
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R4305 (G1)
Quality Score 90
Status Validated
Chromosome 5
Chromosomal Location 143316489-143329256 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) C to T at 143324344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001900] [ENSMUST00000159813] [ENSMUST00000159941] [ENSMUST00000161915] [ENSMUST00000162066] [ENSMUST00000162941] [ENSMUST00000162358]
AlphaFold Q9D6H5
Predicted Effect probably benign
Transcript: ENSMUST00000001900
SMART Domains Protein: ENSMUSP00000001900
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 294 5e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159718
Predicted Effect probably benign
Transcript: ENSMUST00000159813
SMART Domains Protein: ENSMUSP00000137935
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 175 3.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159941
SMART Domains Protein: ENSMUSP00000124026
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 178 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161333
Predicted Effect probably benign
Transcript: ENSMUST00000161915
SMART Domains Protein: ENSMUSP00000124813
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
Pfam:zf-DHHC 144 294 9.7e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162066
SMART Domains Protein: ENSMUSP00000125130
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198455
Predicted Effect probably benign
Transcript: ENSMUST00000162941
SMART Domains Protein: ENSMUSP00000124997
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 97 110 N/A INTRINSIC
Pfam:zf-DHHC 112 176 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162358
SMART Domains Protein: ENSMUSP00000124416
Gene: ENSMUSG00000001844

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Other mutations in Zdhhc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Zdhhc4 APN 5 143320391 missense probably damaging 1.00
R2022:Zdhhc4 UTSW 5 143321783 missense probably damaging 1.00
R2138:Zdhhc4 UTSW 5 143324262 nonsense probably null
R2228:Zdhhc4 UTSW 5 143320407 missense probably damaging 0.98
R4298:Zdhhc4 UTSW 5 143324242 missense probably damaging 0.96
R4722:Zdhhc4 UTSW 5 143321781 missense probably damaging 1.00
R4773:Zdhhc4 UTSW 5 143326176 missense possibly damaging 0.50
R5000:Zdhhc4 UTSW 5 143324933 missense probably damaging 0.98
R5063:Zdhhc4 UTSW 5 143316622 missense probably damaging 1.00
R5341:Zdhhc4 UTSW 5 143326160 missense probably benign 0.01
R5945:Zdhhc4 UTSW 5 143324886 missense probably damaging 1.00
R5956:Zdhhc4 UTSW 5 143324849 intron probably benign
R7284:Zdhhc4 UTSW 5 143321891 missense probably benign 0.01
R7843:Zdhhc4 UTSW 5 143320276 missense probably damaging 1.00
R7955:Zdhhc4 UTSW 5 143321864 missense probably damaging 1.00
R8261:Zdhhc4 UTSW 5 143321833 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTAGCAGCACATAGGGCAG -3'
(R):5'- CCTACATGGCCAGTTTGTTGTC -3'

Sequencing Primer
(F):5'- CAGCACATAGGGCAGGAGAAG -3'
(R):5'- TCTGAGACATGCTTCTGAGACAG -3'
Posted On 2015-06-24