Incidental Mutation 'R4305:Fam71f1'
ID 323994
Institutional Source Beutler Lab
Gene Symbol Fam71f1
Ensembl Gene ENSMUSG00000039742
Gene Name family with sequence similarity 71, member F1
Synonyms LOC330277
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 29319140-29336019 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29326612 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 243 (S243G)
Ref Sequence ENSEMBL: ENSMUSP00000132703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090487] [ENSMUST00000163229] [ENSMUST00000164560] [ENSMUST00000166462]
AlphaFold Q3UZD7
Predicted Effect probably damaging
Transcript: ENSMUST00000090487
AA Change: S243G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087973
Gene: ENSMUSG00000039742
AA Change: S243G

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163229
SMART Domains Protein: ENSMUSP00000132402
Gene: ENSMUSG00000039742

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164560
AA Change: S243G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126496
Gene: ENSMUSG00000039742
AA Change: S243G

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 137 208 7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166462
AA Change: S243G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132703
Gene: ENSMUSG00000039742
AA Change: S243G

DomainStartEndE-ValueType
low complexity region 49 59 N/A INTRINSIC
Pfam:DUF3699 136 210 3.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171782
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Fam71f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Fam71f1 APN 6 29320701 missense probably damaging 0.99
IGL02342:Fam71f1 APN 6 29323830 missense possibly damaging 0.87
R0402:Fam71f1 UTSW 6 29323902 missense probably benign 0.01
R0467:Fam71f1 UTSW 6 29326607 missense probably damaging 1.00
R0610:Fam71f1 UTSW 6 29326577 missense probably benign 0.01
R1773:Fam71f1 UTSW 6 29334153 missense possibly damaging 0.83
R1950:Fam71f1 UTSW 6 29335816 splice site probably null
R4259:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4351:Fam71f1 UTSW 6 29320801 missense probably damaging 1.00
R4508:Fam71f1 UTSW 6 29323765 missense probably benign 0.04
R5014:Fam71f1 UTSW 6 29326724 intron probably benign
R5249:Fam71f1 UTSW 6 29323897 missense probably damaging 1.00
R5506:Fam71f1 UTSW 6 29319298 missense probably damaging 1.00
R6212:Fam71f1 UTSW 6 29319374 missense probably damaging 1.00
R6456:Fam71f1 UTSW 6 29334046 missense probably benign
R6949:Fam71f1 UTSW 6 29323906 missense probably damaging 1.00
R7047:Fam71f1 UTSW 6 29323810 missense probably damaging 1.00
R7562:Fam71f1 UTSW 6 29323834 missense probably damaging 1.00
R8346:Fam71f1 UTSW 6 29334031 missense probably damaging 1.00
R9061:Fam71f1 UTSW 6 29323903 missense probably benign 0.27
X0065:Fam71f1 UTSW 6 29326661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGAGAGACTTGTATGGC -3'
(R):5'- TATGGCAATGACACCAGGTAC -3'

Sequencing Primer
(F):5'- AGAGACTTGTATGGCTGCCTATTG -3'
(R):5'- GTATATCACATCCCTAACCGTGC -3'
Posted On 2015-06-24