Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Cd27'

323995

Institutional Source

Beutler Lab

Gene Symbol

Cd27

Ensembl Gene

ENSMUSG00000030336

Gene Name

CD27 antigen

Synonyms

Cd27, S152, Tnfrsf7, Tp55

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125232622-125237010 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125234670 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 98 (V98A)

Ref Sequence

ENSEMBL: ENSMUSP00000032486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000112281] [ENSMUST00000112282]

AlphaFold

P41272

Predicted Effect

probably benign
Transcript: ENSMUST00000032486
AA Change: V98A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336
AA Change: V98A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	27	62	1.11e-2	SMART
TNFR	65	104	1.23e-4	SMART
low complexity region	131	147	N/A	INTRINSIC
transmembrane domain	183	202	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000043422

SMART Domains

Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IG	202	306	1.11e-5	SMART
IGc1	321	397	3.97e-7	SMART
transmembrane domain	412	434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063588

SMART Domains

Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

Domain	Start	End	E-Value	Type
low complexity region	3	26	N/A	INTRINSIC
Pfam:Synaptobrevin	30	118	5.4e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112281

SMART Domains

Protein: ENSMUSP00000107900
Gene: ENSMUSG00000030336

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TNFR	27	62	1.11e-2	SMART
Blast:TNFR	65	100	4e-10	BLAST
transmembrane domain	120	142	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112282

SMART Domains

Protein: ENSMUSP00000107901
Gene: ENSMUSG00000030336

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:TNFR	27	45	1e-6	BLAST
transmembrane domain	76	98	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151527

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184956

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a normal phenotype. However, T-cell development immune responses are abnormal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Cd27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02222:Cd27	APN	6	125234532	missense	probably damaging	0.98
R2358:Cd27	UTSW	6	125233318	missense	probably damaging	1.00
R3704:Cd27	UTSW	6	125233398	missense	probably damaging	1.00
R3711:Cd27	UTSW	6	125233318	missense	probably damaging	1.00
R4872:Cd27	UTSW	6	125234318	critical splice acceptor site	probably null
R5369:Cd27	UTSW	6	125234364	intron	probably benign
R5762:Cd27	UTSW	6	125236598	missense	probably damaging	1.00
R6577:Cd27	UTSW	6	125236793	missense	probably benign	0.00
R6810:Cd27	UTSW	6	125233664	missense	probably damaging	1.00
R8087:Cd27	UTSW	6	125233362	missense	possibly damaging	0.95
R8162:Cd27	UTSW	6	125233225	splice site	probably null
R9334:Cd27	UTSW	6	125236755	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAAACACAGACTGGGCAGTGC -3'
(R):5'- TGTGTCTGAGCCTGGGAAAG -3'

Sequencing Primer
(F):5'- CTGGGTAGGCAGCCTTCTG -3'
(R):5'- CCTGGGAAAGGTAGCAGGC -3'

Posted On

2015-06-24