Incidental Mutation 'R4305:Cd27'
ID 323995
Institutional Source Beutler Lab
Gene Symbol Cd27
Ensembl Gene ENSMUSG00000030336
Gene Name CD27 antigen
Synonyms Cd27, S152, Tnfrsf7, Tp55
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 125232622-125237010 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125234670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 98 (V98A)
Ref Sequence ENSEMBL: ENSMUSP00000032486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032486] [ENSMUST00000043422] [ENSMUST00000063588] [ENSMUST00000112281] [ENSMUST00000112282]
AlphaFold P41272
Predicted Effect probably benign
Transcript: ENSMUST00000032486
AA Change: V98A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032486
Gene: ENSMUSG00000030336
AA Change: V98A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
TNFR 65 104 1.23e-4 SMART
low complexity region 131 147 N/A INTRINSIC
transmembrane domain 183 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043422
SMART Domains Protein: ENSMUSP00000047105
Gene: ENSMUSG00000038213

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 202 306 1.11e-5 SMART
IGc1 321 397 3.97e-7 SMART
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063588
SMART Domains Protein: ENSMUSP00000063466
Gene: ENSMUSG00000030337

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:Synaptobrevin 30 118 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112281
SMART Domains Protein: ENSMUSP00000107900
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TNFR 27 62 1.11e-2 SMART
Blast:TNFR 65 100 4e-10 BLAST
transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112282
SMART Domains Protein: ENSMUSP00000107901
Gene: ENSMUSG00000030336

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:TNFR 27 45 1e-6 BLAST
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184956
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long-term maintenance of T cell immunity. It binds to ligand CD70, and plays a key role in regulating B-cell activation and immunoglobulin synthesis. This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a normal phenotype. However, T-cell development immune responses are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Cd27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02222:Cd27 APN 6 125234532 missense probably damaging 0.98
R2358:Cd27 UTSW 6 125233318 missense probably damaging 1.00
R3704:Cd27 UTSW 6 125233398 missense probably damaging 1.00
R3711:Cd27 UTSW 6 125233318 missense probably damaging 1.00
R4872:Cd27 UTSW 6 125234318 critical splice acceptor site probably null
R5369:Cd27 UTSW 6 125234364 intron probably benign
R5762:Cd27 UTSW 6 125236598 missense probably damaging 1.00
R6577:Cd27 UTSW 6 125236793 missense probably benign 0.00
R6810:Cd27 UTSW 6 125233664 missense probably damaging 1.00
R8087:Cd27 UTSW 6 125233362 missense possibly damaging 0.95
R8162:Cd27 UTSW 6 125233225 splice site probably null
R9334:Cd27 UTSW 6 125236755 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAACACAGACTGGGCAGTGC -3'
(R):5'- TGTGTCTGAGCCTGGGAAAG -3'

Sequencing Primer
(F):5'- CTGGGTAGGCAGCCTTCTG -3'
(R):5'- CCTGGGAAAGGTAGCAGGC -3'
Posted On 2015-06-24