Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Vmn2r71'

323997

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r71

Ensembl Gene

ENSMUSG00000091205

Gene Name

vomeronasal 2, receptor 71

Synonyms

EG233445

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85574614-85624547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 85624152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 725 (D725Y)

Ref Sequence

ENSEMBL: ENSMUSP00000132337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172338]

AlphaFold

L7N2D8

Predicted Effect

probably damaging
Transcript: ENSMUST00000172338
AA Change: D725Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: D725Y

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	468	2.1e-31	PFAM
Pfam:NCD3G	511	563	8.7e-20	PFAM
Pfam:7tm_3	593	831	2e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208273

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Vmn2r71

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Vmn2r71	APN	7	85618693	missense	probably benign
IGL00960:Vmn2r71	APN	7	85624374	missense	probably damaging	1.00
IGL01372:Vmn2r71	APN	7	85620814	splice site	probably benign
IGL01690:Vmn2r71	APN	7	85615574	missense	probably damaging	1.00
IGL01909:Vmn2r71	APN	7	85620793	missense	probably benign	0.00
IGL01950:Vmn2r71	APN	7	85615619	missense	probably damaging	0.98
IGL02570:Vmn2r71	APN	7	85615540	missense	possibly damaging	0.95
IGL02650:Vmn2r71	APN	7	85624327	missense	probably damaging	1.00
IGL02901:Vmn2r71	APN	7	85619262	missense	probably benign	0.00
IGL03128:Vmn2r71	APN	7	85619587	missense	probably damaging	1.00
IGL03328:Vmn2r71	APN	7	85624291	missense	probably damaging	1.00
R0533:Vmn2r71	UTSW	7	85619218	frame shift	probably null
R0707:Vmn2r71	UTSW	7	85619432	missense	probably benign
R0841:Vmn2r71	UTSW	7	85618541	missense	possibly damaging	0.62
R0865:Vmn2r71	UTSW	7	85619308	missense	probably benign	0.01
R0883:Vmn2r71	UTSW	7	85623634	missense	probably benign	0.19
R0939:Vmn2r71	UTSW	7	85623681	missense	possibly damaging	0.70
R1597:Vmn2r71	UTSW	7	85624144	missense	possibly damaging	0.46
R1646:Vmn2r71	UTSW	7	85621268	missense	probably damaging	0.99
R1719:Vmn2r71	UTSW	7	85621227	missense	probably damaging	1.00
R1860:Vmn2r71	UTSW	7	85615574	missense	probably damaging	1.00
R2013:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2014:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2015:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2050:Vmn2r71	UTSW	7	85624473	missense	probably damaging	1.00
R2084:Vmn2r71	UTSW	7	85618737	missense	probably benign	0.03
R2221:Vmn2r71	UTSW	7	85624093	missense	probably benign	0.40
R2223:Vmn2r71	UTSW	7	85624093	missense	probably benign	0.40
R2245:Vmn2r71	UTSW	7	85624180	missense	probably damaging	1.00
R3115:Vmn2r71	UTSW	7	85623658	missense	probably damaging	0.97
R3122:Vmn2r71	UTSW	7	85615620	nonsense	probably null
R3609:Vmn2r71	UTSW	7	85619662	missense	probably damaging	1.00
R4093:Vmn2r71	UTSW	7	85621234	missense	probably benign	0.00
R4306:Vmn2r71	UTSW	7	85624152	missense	probably damaging	1.00
R4334:Vmn2r71	UTSW	7	85619834	missense	probably benign	0.01
R4569:Vmn2r71	UTSW	7	85624194	missense	possibly damaging	0.66
R4622:Vmn2r71	UTSW	7	85620609	missense	probably benign	0.00
R4915:Vmn2r71	UTSW	7	85621268	missense	probably damaging	0.99
R4956:Vmn2r71	UTSW	7	85619228	missense	probably benign	0.19
R5005:Vmn2r71	UTSW	7	85624144	missense	probably damaging	1.00
R5045:Vmn2r71	UTSW	7	85624389	missense	probably benign	0.00
R5153:Vmn2r71	UTSW	7	85619222	missense	possibly damaging	0.94
R5236:Vmn2r71	UTSW	7	85623669	missense	probably damaging	1.00
R5373:Vmn2r71	UTSW	7	85618542	missense	possibly damaging	0.79
R5405:Vmn2r71	UTSW	7	85619414	missense	probably benign
R5831:Vmn2r71	UTSW	7	85623714	missense	probably benign	0.16
R6061:Vmn2r71	UTSW	7	85619274	missense	probably benign
R6518:Vmn2r71	UTSW	7	85621228	missense	probably damaging	1.00
R6751:Vmn2r71	UTSW	7	85619887	critical splice donor site	probably null
R6920:Vmn2r71	UTSW	7	85623900	missense	probably damaging	1.00
R7358:Vmn2r71	UTSW	7	85624260	missense	possibly damaging	0.81
R7453:Vmn2r71	UTSW	7	85624089	missense	probably benign	0.21
R7560:Vmn2r71	UTSW	7	85623907	missense	probably benign	0.06
R7871:Vmn2r71	UTSW	7	85623661	missense	possibly damaging	0.81
R8267:Vmn2r71	UTSW	7	85615496	missense	probably benign	0.02
R8377:Vmn2r71	UTSW	7	85615499	missense	probably benign
R9278:Vmn2r71	UTSW	7	85620580	missense	probably benign	0.19
R9319:Vmn2r71	UTSW	7	85624486	missense	probably damaging	1.00
R9329:Vmn2r71	UTSW	7	85618742	missense	probably benign	0.00
R9368:Vmn2r71	UTSW	7	85624234	missense	probably damaging	1.00
X0025:Vmn2r71	UTSW	7	85618665	missense	probably benign
Z1186:Vmn2r71	UTSW	7	85623886	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGCAGATCACATTTGCC -3'
(R):5'- AGCATGCTGAATGTCAAGAGC -3'

Sequencing Primer
(F):5'- CAGCAGATCACATTTGCCATTGGG -3'
(R):5'- CATGCTGAATGTCAAGAGCTTGGC -3'

Posted On

2015-06-24