Incidental Mutation 'R4305:Chrdl2'
ID 323998
Institutional Source Beutler Lab
Gene Symbol Chrdl2
Ensembl Gene ENSMUSG00000030732
Gene Name chordin-like 2
Synonyms 1810022C01Rik, Chl2
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 100006172-100034728 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100022022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 116 (T116A)
Ref Sequence ENSEMBL: ENSMUSP00000032977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032977
AA Change: T116A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: T116A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 33 95 1.13e-3 SMART
VWC 111 174 1.58e-1 SMART
low complexity region 207 219 N/A INTRINSIC
VWC 248 310 3.09e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107084
AA Change: T123A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: T123A

DomainStartEndE-ValueType
VWC 40 102 1.13e-3 SMART
VWC 118 181 1.58e-1 SMART
low complexity region 214 226 N/A INTRINSIC
VWC 255 317 3.09e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144808
SMART Domains Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732

DomainStartEndE-ValueType
Blast:VWC 2 34 2e-15 BLAST
low complexity region 67 79 N/A INTRINSIC
low complexity region 96 114 N/A INTRINSIC
Meta Mutation Damage Score 0.2843 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Chrdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Chrdl2 APN 7 100034641 missense probably damaging 0.96
IGL00965:Chrdl2 APN 7 100006653 splice site probably null
IGL01320:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01322:Chrdl2 APN 7 100017041 missense probably damaging 1.00
IGL01977:Chrdl2 APN 7 100022056 missense probably benign 0.33
IGL02170:Chrdl2 APN 7 100034614 missense possibly damaging 0.92
IGL02478:Chrdl2 APN 7 100020983 critical splice donor site probably null
IGL02745:Chrdl2 APN 7 100020963 missense probably damaging 1.00
IGL03117:Chrdl2 APN 7 100027580 missense possibly damaging 0.83
IGL03377:Chrdl2 APN 7 100022052 missense probably benign 0.03
Measley UTSW 7 100010121 critical splice donor site probably null
R1453:Chrdl2 UTSW 7 100016990 missense possibly damaging 0.64
R1900:Chrdl2 UTSW 7 100033664 missense possibly damaging 0.75
R2092:Chrdl2 UTSW 7 100020977 nonsense probably null
R3421:Chrdl2 UTSW 7 100023868 missense probably damaging 1.00
R3949:Chrdl2 UTSW 7 100029205 missense possibly damaging 0.89
R4306:Chrdl2 UTSW 7 100022022 missense probably damaging 1.00
R4776:Chrdl2 UTSW 7 100006541 unclassified probably benign
R5208:Chrdl2 UTSW 7 100023922 missense probably damaging 0.96
R5327:Chrdl2 UTSW 7 100028741 missense probably damaging 1.00
R5859:Chrdl2 UTSW 7 100020907 missense probably damaging 1.00
R5928:Chrdl2 UTSW 7 100009993 start gained probably benign
R6706:Chrdl2 UTSW 7 100010121 critical splice donor site probably null
R7027:Chrdl2 UTSW 7 100022033 missense probably damaging 1.00
R7039:Chrdl2 UTSW 7 100028672 missense probably damaging 1.00
R7357:Chrdl2 UTSW 7 100029207 missense probably benign 0.00
R7468:Chrdl2 UTSW 7 100010125 splice site probably null
R7840:Chrdl2 UTSW 7 100033656 missense probably damaging 0.99
R7870:Chrdl2 UTSW 7 100010042 missense unknown
R7887:Chrdl2 UTSW 7 100029250 missense possibly damaging 0.89
R8394:Chrdl2 UTSW 7 100017085 missense possibly damaging 0.95
R8436:Chrdl2 UTSW 7 100027733 critical splice donor site probably null
R8958:Chrdl2 UTSW 7 100020922 missense probably damaging 1.00
R9242:Chrdl2 UTSW 7 100006536 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGGAAGGCCTAAGTTAGACC -3'
(R):5'- AGCCTCTCTGATCCTTAGAGC -3'

Sequencing Primer
(F):5'- TTAAATGTTGAGAGAAACAGAGTCAG -3'
(R):5'- TGATCCTTAGAGCCCCACC -3'
Posted On 2015-06-24