Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Chrdl2'

323998

Institutional Source

Beutler Lab

Gene Symbol

Chrdl2

Ensembl Gene

ENSMUSG00000030732

Gene Name

chordin-like 2

Synonyms

1810022C01Rik, Chl2

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100006172-100034728 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100022022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 116 (T116A)

Ref Sequence

ENSEMBL: ENSMUSP00000032977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032977] [ENSMUST00000107084]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000032977
AA Change: T116A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032977
Gene: ENSMUSG00000030732
AA Change: T116A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
VWC	33	95	1.13e-3	SMART
VWC	111	174	1.58e-1	SMART
low complexity region	207	219	N/A	INTRINSIC
VWC	248	310	3.09e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107084
AA Change: T123A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000102699
Gene: ENSMUSG00000030732
AA Change: T123A

Domain	Start	End	E-Value	Type
VWC	40	102	1.13e-3	SMART
VWC	118	181	1.58e-1	SMART
low complexity region	214	226	N/A	INTRINSIC
VWC	255	317	3.09e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144808

SMART Domains

Protein: ENSMUSP00000120760
Gene: ENSMUSG00000030732

Domain	Start	End	E-Value	Type
Blast:VWC	2	34	2e-15	BLAST
low complexity region	67	79	N/A	INTRINSIC
low complexity region	96	114	N/A	INTRINSIC

Meta Mutation Damage Score

0.2843

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chordin family of proteins. Chordin family members are secreted proteins that share a cysteine-rich pro-collagen repeat domain and associate with members of the transforming growth factor beta superfamily. In vitro assays demonstrate a direct interaction between the encoded protein and human activin A. This gene is expressed in many tissues including osteoblasts, where it is differentially expressed during differentiation. In addition, its expression is upregulated in human osteoarthritic joint cartilage, suggesting a role in adult cartilage regeneration. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Chrdl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Chrdl2	APN	7	100034641	missense	probably damaging	0.96
IGL00965:Chrdl2	APN	7	100006653	splice site	probably null
IGL01320:Chrdl2	APN	7	100017041	missense	probably damaging	1.00
IGL01322:Chrdl2	APN	7	100017041	missense	probably damaging	1.00
IGL01977:Chrdl2	APN	7	100022056	missense	probably benign	0.33
IGL02170:Chrdl2	APN	7	100034614	missense	possibly damaging	0.92
IGL02478:Chrdl2	APN	7	100020983	critical splice donor site	probably null
IGL02745:Chrdl2	APN	7	100020963	missense	probably damaging	1.00
IGL03117:Chrdl2	APN	7	100027580	missense	possibly damaging	0.83
IGL03377:Chrdl2	APN	7	100022052	missense	probably benign	0.03
Measley	UTSW	7	100010121	critical splice donor site	probably null
R1453:Chrdl2	UTSW	7	100016990	missense	possibly damaging	0.64
R1900:Chrdl2	UTSW	7	100033664	missense	possibly damaging	0.75
R2092:Chrdl2	UTSW	7	100020977	nonsense	probably null
R3421:Chrdl2	UTSW	7	100023868	missense	probably damaging	1.00
R3949:Chrdl2	UTSW	7	100029205	missense	possibly damaging	0.89
R4306:Chrdl2	UTSW	7	100022022	missense	probably damaging	1.00
R4776:Chrdl2	UTSW	7	100006541	unclassified	probably benign
R5208:Chrdl2	UTSW	7	100023922	missense	probably damaging	0.96
R5327:Chrdl2	UTSW	7	100028741	missense	probably damaging	1.00
R5859:Chrdl2	UTSW	7	100020907	missense	probably damaging	1.00
R5928:Chrdl2	UTSW	7	100009993	start gained	probably benign
R6706:Chrdl2	UTSW	7	100010121	critical splice donor site	probably null
R7027:Chrdl2	UTSW	7	100022033	missense	probably damaging	1.00
R7039:Chrdl2	UTSW	7	100028672	missense	probably damaging	1.00
R7357:Chrdl2	UTSW	7	100029207	missense	probably benign	0.00
R7468:Chrdl2	UTSW	7	100010125	splice site	probably null
R7840:Chrdl2	UTSW	7	100033656	missense	probably damaging	0.99
R7870:Chrdl2	UTSW	7	100010042	missense	unknown
R7887:Chrdl2	UTSW	7	100029250	missense	possibly damaging	0.89
R8394:Chrdl2	UTSW	7	100017085	missense	possibly damaging	0.95
R8436:Chrdl2	UTSW	7	100027733	critical splice donor site	probably null
R8958:Chrdl2	UTSW	7	100020922	missense	probably damaging	1.00
R9242:Chrdl2	UTSW	7	100006536	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGGAAGGCCTAAGTTAGACC -3'
(R):5'- AGCCTCTCTGATCCTTAGAGC -3'

Sequencing Primer
(F):5'- TTAAATGTTGAGAGAAACAGAGTCAG -3'
(R):5'- TGATCCTTAGAGCCCCACC -3'

Posted On

2015-06-24