Incidental Mutation 'R4305:Ccr5'
ID 324001
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Name C-C motif chemokine receptor 5
Synonyms CD195, Cmkbr5
MMRRC Submission 041091-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 123921557-123934153 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123925111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 238 (L238P)
Ref Sequence ENSEMBL: ENSMUSP00000107069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
AlphaFold P51682
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect possibly damaging
Transcript: ENSMUST00000111442
AA Change: L238P

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: L238P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169553
Predicted Effect probably benign
Transcript: ENSMUST00000171499
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171579
Meta Mutation Damage Score 0.7355 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 12,042,300 (GRCm39) S440* probably null Het
Abl2 T A 1: 156,469,133 (GRCm39) M695K probably damaging Het
Asap2 T C 12: 21,279,482 (GRCm39) I426T probably damaging Het
Atxn7l1 T C 12: 33,391,991 (GRCm39) M93T probably damaging Het
Cd27 A G 6: 125,211,633 (GRCm39) V98A probably benign Het
Ceacam23 T A 7: 17,639,118 (GRCm39) Y372N probably benign Het
Cfap47 C G X: 78,541,635 (GRCm39) K469N probably damaging Het
Chrdl2 A G 7: 99,671,229 (GRCm39) T116A probably damaging Het
Epha6 T C 16: 60,346,883 (GRCm39) probably null Het
Garin1b A G 6: 29,326,611 (GRCm39) S243G probably damaging Het
Gart T C 16: 91,430,880 (GRCm39) E394G possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lpar6 G A 14: 73,476,381 (GRCm39) R114Q probably damaging Het
Med23 G T 10: 24,780,168 (GRCm39) E573* probably null Het
Mtch2 A G 2: 90,689,827 (GRCm39) I183V probably benign Het
Nlrp3 C T 11: 59,438,836 (GRCm39) R138* probably null Het
Notch1 T C 2: 26,367,936 (GRCm39) D657G probably damaging Het
Or4k37 A G 2: 111,159,643 (GRCm39) D293G probably null Het
Rbm20 A G 19: 53,831,691 (GRCm39) S642G probably damaging Het
Tex11 C A X: 99,977,021 (GRCm39) A487S possibly damaging Het
Ttn T C 2: 76,748,681 (GRCm39) S4123G probably benign Het
Ugt3a1 A C 15: 9,306,360 (GRCm39) S170R possibly damaging Het
Vmn2r71 G T 7: 85,273,360 (GRCm39) D725Y probably damaging Het
Vps9d1 G T 8: 123,974,976 (GRCm39) probably benign Het
Yeats2 A G 16: 20,027,172 (GRCm39) T808A probably damaging Het
Zdhhc4 C T 5: 143,310,099 (GRCm39) probably benign Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 123,924,443 (GRCm39) missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 123,924,625 (GRCm39) missense probably damaging 1.00
IGL01153:Ccr5 APN 9 123,924,649 (GRCm39) missense probably damaging 1.00
R0014:Ccr5 UTSW 9 123,924,658 (GRCm39) missense probably damaging 1.00
R0014:Ccr5 UTSW 9 123,924,658 (GRCm39) missense probably damaging 1.00
R0355:Ccr5 UTSW 9 123,924,951 (GRCm39) missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 123,925,000 (GRCm39) missense probably benign 0.29
R4307:Ccr5 UTSW 9 123,925,111 (GRCm39) missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 123,924,912 (GRCm39) nonsense probably null
R4589:Ccr5 UTSW 9 123,924,539 (GRCm39) missense probably benign 0.00
R5549:Ccr5 UTSW 9 123,925,408 (GRCm39) missense probably benign 0.09
R5566:Ccr5 UTSW 9 123,924,697 (GRCm39) missense probably benign 0.07
R5871:Ccr5 UTSW 9 123,924,558 (GRCm39) missense probably benign 0.02
R6568:Ccr5 UTSW 9 123,925,236 (GRCm39) missense probably damaging 0.99
R7258:Ccr5 UTSW 9 123,925,311 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCCTCTCTCCCAGAAATAATC -3'
(R):5'- TAGGCAGCAGTGTGTCATTC -3'

Sequencing Primer
(F):5'- CCAGATCTCAGAAAGAAGGTTTTC -3'
(R):5'- CAGCAGTGTGTCATTCCAAGAGTC -3'
Posted On 2015-06-24