Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Atxn7l1'

324005

Institutional Source

Beutler Lab

Gene Symbol

Atxn7l1

Ensembl Gene

ENSMUSG00000020564

Gene Name

ataxin 7-like 1

Synonyms

Atxn7l4, 2810423G08Rik

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33147693-33373185 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33341992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 93 (M93T)

Ref Sequence

ENSEMBL: ENSMUSP00000122982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000146040] [ENSMUST00000154742]

AlphaFold

Q9CZ05

Predicted Effect

probably damaging
Transcript: ENSMUST00000090597
AA Change: M93T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564
AA Change: M93T

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	95	110	N/A	INTRINSIC
Pfam:SCA7	143	220	2.5e-31	PFAM
low complexity region	274	288	N/A	INTRINSIC
low complexity region	380	392	N/A	INTRINSIC
low complexity region	471	501	N/A	INTRINSIC
low complexity region	519	538	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125192
AA Change: M189T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564
AA Change: M189T

Domain	Start	End	E-Value	Type
low complexity region	95	114	N/A	INTRINSIC
low complexity region	191	206	N/A	INTRINSIC
Pfam:SCA7	246	314	2e-28	PFAM
low complexity region	370	384	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	567	597	N/A	INTRINSIC
low complexity region	615	634	N/A	INTRINSIC
low complexity region	792	810	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126275

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133549

SMART Domains

Protein: ENSMUSP00000120569
Gene: ENSMUSG00000020564

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	95	110	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146040
AA Change: M189T

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564
AA Change: M189T

Domain	Start	End	E-Value	Type
low complexity region	95	114	N/A	INTRINSIC
low complexity region	191	206	N/A	INTRINSIC
Pfam:SCA7	246	314	2.3e-28	PFAM
low complexity region	370	384	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	578	590	N/A	INTRINSIC
low complexity region	669	699	N/A	INTRINSIC
low complexity region	717	736	N/A	INTRINSIC
low complexity region	894	912	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154742
AA Change: M93T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564
AA Change: M93T

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	95	110	N/A	INTRINSIC
Pfam:SCA7	150	218	1.3e-31	PFAM
low complexity region	274	288	N/A	INTRINSIC
low complexity region	380	392	N/A	INTRINSIC
low complexity region	471	501	N/A	INTRINSIC
low complexity region	519	538	N/A	INTRINSIC
low complexity region	696	714	N/A	INTRINSIC

Meta Mutation Damage Score

0.1031

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Atxn7l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02130:Atxn7l1	APN	12	33342142	missense	probably damaging	1.00
IGL02146:Atxn7l1	APN	12	33368031	missense	probably benign
IGL02202:Atxn7l1	APN	12	33342078	missense	probably benign	0.05
IGL02804:Atxn7l1	APN	12	33367789	missense	probably damaging	1.00
IGL03344:Atxn7l1	APN	12	33326066	missense	probably damaging	1.00
R0270:Atxn7l1	UTSW	12	33342151	missense	possibly damaging	0.58
R0621:Atxn7l1	UTSW	12	33326100	missense	probably benign	0.15
R1840:Atxn7l1	UTSW	12	33371033	splice site	probably null
R1856:Atxn7l1	UTSW	12	33358770	missense	probably damaging	1.00
R1992:Atxn7l1	UTSW	12	33358744	missense	probably damaging	1.00
R1993:Atxn7l1	UTSW	12	33345977	missense	probably benign
R2249:Atxn7l1	UTSW	12	33358840	missense	probably damaging	1.00
R2369:Atxn7l1	UTSW	12	33358850	critical splice donor site	probably null
R3695:Atxn7l1	UTSW	12	33358697	missense	probably damaging	1.00
R3856:Atxn7l1	UTSW	12	33367600	missense	probably damaging	1.00
R3976:Atxn7l1	UTSW	12	33325955	missense	probably damaging	1.00
R4151:Atxn7l1	UTSW	12	33364482	missense	probably damaging	0.96
R4301:Atxn7l1	UTSW	12	33367238	missense	probably damaging	1.00
R4411:Atxn7l1	UTSW	12	33194887	intron	probably benign
R4763:Atxn7l1	UTSW	12	33358878	intron	probably benign
R5049:Atxn7l1	UTSW	12	33358687	missense	probably benign	0.00
R5090:Atxn7l1	UTSW	12	33326078	missense	probably damaging	1.00
R5134:Atxn7l1	UTSW	12	33372876	missense	probably damaging	1.00
R5425:Atxn7l1	UTSW	12	33367120	missense	probably damaging	1.00
R6161:Atxn7l1	UTSW	12	33358663	missense	possibly damaging	0.62
R6813:Atxn7l1	UTSW	12	33367124	missense	probably damaging	0.96
R7248:Atxn7l1	UTSW	12	33367195	missense	probably benign	0.26
R7328:Atxn7l1	UTSW	12	33148503	critical splice donor site	probably null
R8020:Atxn7l1	UTSW	12	33325953	missense	probably benign	0.10
R8057:Atxn7l1	UTSW	12	33326002	missense	probably damaging	0.99
R8353:Atxn7l1	UTSW	12	33147883	missense	probably damaging	0.99
R8523:Atxn7l1	UTSW	12	33346024	missense	probably benign
R9051:Atxn7l1	UTSW	12	33367421	missense	probably benign	0.00
R9350:Atxn7l1	UTSW	12	33367316	missense	probably benign	0.01
Z1176:Atxn7l1	UTSW	12	33367645	missense	probably benign	0.00
Z1176:Atxn7l1	UTSW	12	33368017	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCACGCTGCTCGCTTACAG -3'
(R):5'- TGAAAGTCTCCGGTAAGGCTTG -3'

Sequencing Primer
(F):5'- TGCTCGCTTACAGCAGGAG -3'
(R):5'- CTCCGGTAAGGCTTGTTGCTG -3'

Posted On

2015-06-24