Mutagenetix > Incidental Mutations

Incidental Mutation 'R4305:Lpar6'

324006

Institutional Source

Beutler Lab

Gene Symbol

Lpar6

Ensembl Gene

ENSMUSG00000033446

Gene Name

lysophosphatidic acid receptor 6

Synonyms

2610302I02Rik, P2ry5, P2y5

MMRRC Submission

041091-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73237895-73243294 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73238941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 114 (R114Q)

Ref Sequence

ENSEMBL: ENSMUSP00000042327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000044405]

AlphaFold

Q8BMC0

Predicted Effect

probably benign
Transcript: ENSMUST00000022701

SMART Domains

Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105

Domain	Start	End	E-Value	Type
low complexity region	2	28	N/A	INTRINSIC
low complexity region	37	53	N/A	INTRINSIC
DUF3452	97	223	4.59e-25	SMART
RB_A	367	567	5.53e-92	SMART
CYCLIN	653	740	1.62e-5	SMART
Rb_C	761	920	1.28e-96	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000044405
AA Change: R114Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042327
Gene: ENSMUSG00000033446
AA Change: R114Q

Domain	Start	End	E-Value	Type
Pfam:7tm_1	34	291	2.3e-51	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163932

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170967

Meta Mutation Damage Score

0.8816

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene aligns with an internal intron of the retinoblastoma susceptibility gene in the reverse orientation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Rbm20	A	G	19: 53,843,260	S642G	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Lpar6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Lpar6	APN	14	73238637	missense	probably damaging	1.00
IGL01611:Lpar6	APN	14	73239438	missense	probably damaging	1.00
IGL01618:Lpar6	APN	14	73239066	missense	probably damaging	0.96
IGL01676:Lpar6	APN	14	73239570	missense	probably benign	0.24
IGL03031:Lpar6	APN	14	73239442	missense	possibly damaging	0.64
IGL03061:Lpar6	APN	14	73239070	missense	probably benign	0.03
R1900:Lpar6	UTSW	14	73239139	missense	probably benign	0.01
R2895:Lpar6	UTSW	14	73239276	missense	probably damaging	1.00
R2896:Lpar6	UTSW	14	73239276	missense	probably damaging	1.00
R3972:Lpar6	UTSW	14	73239073	missense	probably benign	0.01
R4827:Lpar6	UTSW	14	73238750	missense	probably damaging	1.00
R4989:Lpar6	UTSW	14	73238707	missense	probably damaging	1.00
R5024:Lpar6	UTSW	14	73239369	missense	probably damaging	0.99
R5133:Lpar6	UTSW	14	73238707	missense	probably damaging	1.00
R5173:Lpar6	UTSW	14	73239097	missense	probably benign	0.01
R5931:Lpar6	UTSW	14	73238928	missense	probably damaging	1.00
R6283:Lpar6	UTSW	14	73238857	missense	probably damaging	1.00
R6316:Lpar6	UTSW	14	73239334	missense	probably damaging	1.00
R7414:Lpar6	UTSW	14	73238800	missense	probably damaging	1.00
R7868:Lpar6	UTSW	14	73238995	missense	probably damaging	1.00
R8749:Lpar6	UTSW	14	73239510	missense	probably benign
R9098:Lpar6	UTSW	14	73238793	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCATCTGTGCCCTCAAAGTG -3'
(R):5'- CGCTGGAAAGTTCTCAAAGCAG -3'

Sequencing Primer
(F):5'- CAACGTACATGATTAACCTGGCAATG -3'
(R):5'- TCTCAAAGCAGGCTTCTGAG -3'

Posted On

2015-06-24