Incidental Mutation 'R4305:Lpar6'
ID 324006
Institutional Source Beutler Lab
Gene Symbol Lpar6
Ensembl Gene ENSMUSG00000033446
Gene Name lysophosphatidic acid receptor 6
Synonyms 2610302I02Rik, P2ry5, P2y5
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4305 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 73237895-73243294 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 73238941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 114 (R114Q)
Ref Sequence ENSEMBL: ENSMUSP00000042327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000044405]
AlphaFold Q8BMC0
Predicted Effect probably benign
Transcript: ENSMUST00000022701
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000044405
AA Change: R114Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042327
Gene: ENSMUSG00000033446
AA Change: R114Q

DomainStartEndE-ValueType
Pfam:7tm_1 34 291 2.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170967
Meta Mutation Damage Score 0.8816 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of G-protein coupled receptors, that are preferentially activated by adenosine and uridine nucleotides. This gene aligns with an internal intron of the retinoblastoma susceptibility gene in the reverse orientation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Lpar6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Lpar6 APN 14 73238637 missense probably damaging 1.00
IGL01611:Lpar6 APN 14 73239438 missense probably damaging 1.00
IGL01618:Lpar6 APN 14 73239066 missense probably damaging 0.96
IGL01676:Lpar6 APN 14 73239570 missense probably benign 0.24
IGL03031:Lpar6 APN 14 73239442 missense possibly damaging 0.64
IGL03061:Lpar6 APN 14 73239070 missense probably benign 0.03
R1900:Lpar6 UTSW 14 73239139 missense probably benign 0.01
R2895:Lpar6 UTSW 14 73239276 missense probably damaging 1.00
R2896:Lpar6 UTSW 14 73239276 missense probably damaging 1.00
R3972:Lpar6 UTSW 14 73239073 missense probably benign 0.01
R4827:Lpar6 UTSW 14 73238750 missense probably damaging 1.00
R4989:Lpar6 UTSW 14 73238707 missense probably damaging 1.00
R5024:Lpar6 UTSW 14 73239369 missense probably damaging 0.99
R5133:Lpar6 UTSW 14 73238707 missense probably damaging 1.00
R5173:Lpar6 UTSW 14 73239097 missense probably benign 0.01
R5931:Lpar6 UTSW 14 73238928 missense probably damaging 1.00
R6283:Lpar6 UTSW 14 73238857 missense probably damaging 1.00
R6316:Lpar6 UTSW 14 73239334 missense probably damaging 1.00
R7414:Lpar6 UTSW 14 73238800 missense probably damaging 1.00
R7868:Lpar6 UTSW 14 73238995 missense probably damaging 1.00
R8749:Lpar6 UTSW 14 73239510 missense probably benign
R9098:Lpar6 UTSW 14 73238793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCATCTGTGCCCTCAAAGTG -3'
(R):5'- CGCTGGAAAGTTCTCAAAGCAG -3'

Sequencing Primer
(F):5'- CAACGTACATGATTAACCTGGCAATG -3'
(R):5'- TCTCAAAGCAGGCTTCTGAG -3'
Posted On 2015-06-24