Incidental Mutation 'R0004:Akap12'
ID32401
Institutional Source Beutler Lab
Gene Symbol Akap12
Ensembl Gene ENSMUSG00000038587
Gene NameA kinase (PRKA) anchor protein (gravin) 12
SynonymsSSeCKS, Tsga12, Srcs5
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location4266380-4359470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4353220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 10 (D10V)
Ref Sequence ENSEMBL: ENSMUSP00000150261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045730] [ENSMUST00000215696]
Predicted Effect probably damaging
Transcript: ENSMUST00000045730
AA Change: D115V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035829
Gene: ENSMUSG00000038587
AA Change: D115V

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 151 171 N/A INTRINSIC
low complexity region 187 198 N/A INTRINSIC
internal_repeat_1 212 279 3.2e-5 PROSPERO
coiled coil region 304 331 N/A INTRINSIC
low complexity region 387 398 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
low complexity region 497 526 N/A INTRINSIC
low complexity region 550 561 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
Pfam:WSK 591 619 2e-15 PFAM
low complexity region 626 637 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
low complexity region 700 711 N/A INTRINSIC
Pfam:WSK 738 766 2.3e-15 PFAM
Pfam:WSK 779 807 6.2e-11 PFAM
low complexity region 951 973 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
internal_repeat_1 1197 1265 3.2e-5 PROSPERO
low complexity region 1303 1312 N/A INTRINSIC
Pfam:RII_binding_1 1501 1518 4.2e-7 PFAM
coiled coil region 1651 1676 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215696
AA Change: D10V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216139
Meta Mutation Damage Score 0.2161 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed in endothelial cells, cultured fibroblasts, and osteosarcoma cells. It associates with protein kinases A and C and phosphatase, and serves as a scaffold protein in signal transduction. This protein and RII PKA colocalize at the cell periphery. This protein is a cell growth-related protein. Antibodies to this protein can be produced by patients with myasthenia gravis. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele disrupting all three common isoforms suffer from prostatic hyperplasia and focal dysplasia, and from delayed fertility. Mice homozygous for a gene trap allele exhibit enhanced cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Rbm15b T C 9: 106,884,936 T678A probably benign Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Akap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Akap12 APN 10 4357164 missense probably benign 0.09
IGL01306:Akap12 APN 10 4353273 missense probably benign 0.04
IGL01360:Akap12 APN 10 4357537 missense probably benign 0.02
IGL01455:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL01458:Akap12 APN 10 4354060 missense probably damaging 1.00
IGL01465:Akap12 APN 10 4356886 missense probably damaging 0.99
IGL02348:Akap12 APN 10 4354722 missense probably damaging 1.00
IGL02425:Akap12 APN 10 4356034 missense possibly damaging 0.67
IGL02502:Akap12 APN 10 4353163 missense probably damaging 1.00
IGL02736:Akap12 APN 10 4355637 missense probably benign
IGL02969:Akap12 APN 10 4354864 missense probably damaging 1.00
IGL03345:Akap12 APN 10 4356697 missense probably benign 0.42
ANU23:Akap12 UTSW 10 4353273 missense probably benign 0.04
FR4976:Akap12 UTSW 10 4353837 small insertion probably benign
R0004:Akap12 UTSW 10 4353218 missense possibly damaging 0.56
R0207:Akap12 UTSW 10 4353333 missense probably damaging 1.00
R0580:Akap12 UTSW 10 4354741 missense possibly damaging 0.91
R0675:Akap12 UTSW 10 4353315 missense probably benign 0.06
R1248:Akap12 UTSW 10 4353847 missense probably benign 0.11
R1338:Akap12 UTSW 10 4313773 missense possibly damaging 0.95
R1448:Akap12 UTSW 10 4355475 missense probably benign 0.22
R1458:Akap12 UTSW 10 4353693 missense probably damaging 1.00
R1521:Akap12 UTSW 10 4354804 missense probably benign 0.02
R1585:Akap12 UTSW 10 4353640 missense probably benign 0.11
R1725:Akap12 UTSW 10 4353942 missense probably damaging 1.00
R1756:Akap12 UTSW 10 4357574 missense probably benign 0.04
R1914:Akap12 UTSW 10 4356685 missense probably benign 0.01
R1978:Akap12 UTSW 10 4313855 missense probably benign 0.06
R2032:Akap12 UTSW 10 4356673 missense possibly damaging 0.50
R2041:Akap12 UTSW 10 4356489 missense probably benign 0.01
R3009:Akap12 UTSW 10 4357891 missense probably benign 0.06
R3872:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3874:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3875:Akap12 UTSW 10 4357590 missense probably benign 0.00
R3944:Akap12 UTSW 10 4357347 missense probably benign 0.00
R4612:Akap12 UTSW 10 4354456 missense probably damaging 1.00
R4889:Akap12 UTSW 10 4356535 missense probably damaging 0.97
R5043:Akap12 UTSW 10 4355047 missense probably damaging 1.00
R5176:Akap12 UTSW 10 4353947 missense probably benign 0.19
R5278:Akap12 UTSW 10 4354792 missense probably benign 0.02
R5320:Akap12 UTSW 10 4357291 missense probably benign 0.00
R5443:Akap12 UTSW 10 4355576 missense probably damaging 1.00
R5533:Akap12 UTSW 10 4357405 missense probably damaging 1.00
R6133:Akap12 UTSW 10 4355178 missense probably benign 0.05
R6142:Akap12 UTSW 10 4313740 splice site probably null
R6190:Akap12 UTSW 10 4356268 missense possibly damaging 0.92
R6458:Akap12 UTSW 10 4355148 missense probably damaging 1.00
R6562:Akap12 UTSW 10 4356141 nonsense probably null
R6701:Akap12 UTSW 10 4355243 missense probably damaging 1.00
R6828:Akap12 UTSW 10 4354606 missense probably damaging 0.96
R6991:Akap12 UTSW 10 4357122 nonsense probably null
R7023:Akap12 UTSW 10 4356895 missense probably benign 0.05
R7102:Akap12 UTSW 10 4353226 missense probably damaging 1.00
R7483:Akap12 UTSW 10 4353967 missense probably benign 0.00
R7538:Akap12 UTSW 10 4353213 missense probably damaging 1.00
R7664:Akap12 UTSW 10 4353748 missense probably damaging 1.00
R7704:Akap12 UTSW 10 4356082 missense probably damaging 1.00
R8447:Akap12 UTSW 10 4356289 missense probably benign 0.32
R8502:Akap12 UTSW 10 4313856 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGCCAAGCGTGTAGCGCCTTTG -3'
(R):5'- ATGCTGATTCGCCGACGGTCTC -3'

Sequencing Primer
(F):5'- CATGGTCCAATCTATGAAACATTTAC -3'
(R):5'- ATCCTTCTTGACAGTGAGTAGC -3'
Posted On2013-05-09