Incidental Mutation 'R4305:Gart'
ID324011
Institutional Source Beutler Lab
Gene Symbol Gart
Ensembl Gene ENSMUSG00000022962
Gene Namephosphoribosylglycinamide formyltransferase
SynonymsGaps, Prgs
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4305 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location91621186-91646952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91633992 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 394 (E394G)
Ref Sequence ENSEMBL: ENSMUSP00000156002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023684] [ENSMUST00000120450] [ENSMUST00000156713] [ENSMUST00000231380] [ENSMUST00000232289] [ENSMUST00000232367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023684
AA Change: E394G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023684
Gene: ENSMUSG00000022962
AA Change: E394G

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 6.4e-37 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Pfam:AIRS 473 593 1.2e-17 PFAM
Pfam:AIRS_C 606 777 9e-40 PFAM
Pfam:Formyl_trans_N 808 988 3.4e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120450
AA Change: E394G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114034
Gene: ENSMUSG00000022962
AA Change: E394G

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.8e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
GARS_C 333 426 1.33e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156713
SMART Domains Protein: ENSMUSP00000119272
Gene: ENSMUSG00000022962

DomainStartEndE-ValueType
Pfam:GARS_N 3 104 1.4e-40 PFAM
GARS_A 105 298 4.42e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000231380
AA Change: E394G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231702
Predicted Effect possibly damaging
Transcript: ENSMUST00000232289
AA Change: E394G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000232367
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a trifunctional polypeptide. It has phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase activity which is required for de novo purine biosynthesis. This enzyme is highly conserved in vertebrates. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Gart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gart APN 16 91638789 missense possibly damaging 0.58
IGL00837:Gart APN 16 91638720 unclassified probably benign
IGL01010:Gart APN 16 91643092 nonsense probably null
IGL01064:Gart APN 16 91623007 missense probably damaging 1.00
IGL01451:Gart APN 16 91625512 missense probably benign
IGL02084:Gart APN 16 91621600 missense probably benign
IGL02301:Gart APN 16 91621837 splice site probably benign
IGL02814:Gart APN 16 91623457 missense possibly damaging 0.58
sylvester UTSW 16 91630602 splice site probably benign
PIT4453001:Gart UTSW 16 91636538 missense probably damaging 1.00
R0137:Gart UTSW 16 91625394 missense probably benign
R0197:Gart UTSW 16 91623403 missense possibly damaging 0.95
R0321:Gart UTSW 16 91623037 unclassified probably benign
R0322:Gart UTSW 16 91623037 unclassified probably benign
R0398:Gart UTSW 16 91639449 missense probably damaging 1.00
R0410:Gart UTSW 16 91641327 missense probably damaging 1.00
R0496:Gart UTSW 16 91623037 unclassified probably benign
R0620:Gart UTSW 16 91630602 splice site probably benign
R0628:Gart UTSW 16 91633902 missense probably benign 0.01
R0883:Gart UTSW 16 91623403 missense possibly damaging 0.95
R1346:Gart UTSW 16 91628182 splice site probably null
R1490:Gart UTSW 16 91624344 missense probably damaging 1.00
R1686:Gart UTSW 16 91625349 missense probably damaging 1.00
R1751:Gart UTSW 16 91642949 splice site probably benign
R1917:Gart UTSW 16 91628149 missense probably damaging 1.00
R2144:Gart UTSW 16 91630081 missense probably damaging 1.00
R2421:Gart UTSW 16 91643040 splice site probably null
R4377:Gart UTSW 16 91634094 missense probably benign 0.31
R4599:Gart UTSW 16 91622945 nonsense probably null
R4619:Gart UTSW 16 91625433 missense probably damaging 1.00
R4620:Gart UTSW 16 91625433 missense probably damaging 1.00
R5112:Gart UTSW 16 91634045 missense probably benign 0.02
R5902:Gart UTSW 16 91628527 missense probably damaging 1.00
R5975:Gart UTSW 16 91624336 missense probably damaging 1.00
R6736:Gart UTSW 16 91636107 missense probably benign 0.21
R7041:Gart UTSW 16 91643143 start gained probably benign
R7150:Gart UTSW 16 91628463 missense possibly damaging 0.69
R7320:Gart UTSW 16 91621681 missense probably benign 0.00
R7709:Gart UTSW 16 91622965 missense possibly damaging 0.92
R7748:Gart UTSW 16 91630652 missense possibly damaging 0.66
R7911:Gart UTSW 16 91638784 missense probably benign 0.23
R8066:Gart UTSW 16 91639447 missense probably benign
R8209:Gart UTSW 16 91628153 missense possibly damaging 0.78
R8824:Gart UTSW 16 91630703 missense possibly damaging 0.64
R8840:Gart UTSW 16 91636122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGCAATGACTTAAAACGGAACTAGC -3'
(R):5'- GCTCTACATAGTAAAGACCCTGTC -3'

Sequencing Primer
(F):5'- AACTAGCCGAGTTTCCTCCCAG -3'
(R):5'- GACTGCAGGTATTCCATG -3'
Posted On2015-06-24