Incidental Mutation 'R4305:Rbm20'
ID324013
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4305 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53843260 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 642 (S642G)
Ref Sequence ENSEMBL: ENSMUSP00000093665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]
Predicted Effect probably damaging
Transcript: ENSMUST00000095969
AA Change: S642G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: S642G

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161856
AA Change: S17G
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: S17G

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164202
AA Change: S642G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: S642G

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Gm7173 C G X: 79,498,029 K469N probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8292:Rbm20 UTSW 19 53851499 missense possibly damaging 0.71
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53851492 missense probably benign 0.18
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCTGCACTACTGGGTTGC -3'
(R):5'- TTCGAGTCGCTCATCCAAC -3'

Sequencing Primer
(F):5'- CACTACTGGGTTGCGACAAAAG -3'
(R):5'- TGTCCAGCTGCCTAGGATAG -3'
Posted On2015-06-24