Mutagenetix > Incidental Mutation

Incidental Mutation 'R4305:Rbm20'

324013

Institutional Source

Beutler Lab

Gene Symbol

Rbm20

Ensembl Gene

ENSMUSG00000043639

Gene Name

RNA binding motif protein 20

Synonyms

2010003H22Rik, 1110018J23Rik

MMRRC Submission

041091-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R4305 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53677306-53867080 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53843260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 642 (S642G)

Ref Sequence

ENSEMBL: ENSMUSP00000093665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095969] [ENSMUST00000164202]

AlphaFold

Q3UQS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095969
AA Change: S642G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093665
Gene: ENSMUSG00000043639
AA Change: S642G

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000161856
AA Change: S17G

SMART Domains

Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: S17G

Domain	Start	End	E-Value	Type
low complexity region	10	33	N/A	INTRINSIC
low complexity region	180	191	N/A	INTRINSIC
low complexity region	209	220	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164202
AA Change: S642G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: S642G

Domain	Start	End	E-Value	Type
low complexity region	25	61	N/A	INTRINSIC
low complexity region	106	117	N/A	INTRINSIC
low complexity region	170	183	N/A	INTRINSIC
low complexity region	251	260	N/A	INTRINSIC
ZnF_U1	410	444	6.79e-1	SMART
ZnF_C2H2	413	437	4.69e0	SMART
RRM	521	591	4.01e-5	SMART
low complexity region	634	657	N/A	INTRINSIC
low complexity region	804	815	N/A	INTRINSIC
low complexity region	833	844	N/A	INTRINSIC
ZnF_U1	1130	1165	7.26e-6	SMART
ZnF_C2H2	1133	1158	3.13e1	SMART

Meta Mutation Damage Score

0.1072

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

92% (36/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Abl2	T	A	1: 156,641,563	M695K	probably damaging	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Atxn7l1	T	C	12: 33,341,992	M93T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cd27	A	G	6: 125,234,670	V98A	probably benign	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Epha6	T	C	16: 60,526,520		probably null	Het
Fam71f1	A	G	6: 29,326,612	S243G	probably damaging	Het
Gart	T	C	16: 91,633,992	E394G	possibly damaging	Het
Gm5155	T	A	7: 17,905,193	Y372N	probably benign	Het
Gm7173	C	G	X: 79,498,029	K469N	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lpar6	G	A	14: 73,238,941	R114Q	probably damaging	Het
Med23	G	T	10: 24,904,270	E573*	probably null	Het
Mtch2	A	G	2: 90,859,483	I183V	probably benign	Het
Nlrp3	C	T	11: 59,548,010	R138*	probably null	Het
Notch1	T	C	2: 26,477,924	D657G	probably damaging	Het
Olfr1281	A	G	2: 111,329,298	D293G	probably null	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Ttn	T	C	2: 76,918,337	S4123G	probably benign	Het
Ugt3a1	A	C	15: 9,306,274	S170R	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Vps9d1	G	T	8: 123,248,237		probably benign	Het
Yeats2	A	G	16: 20,208,422	T808A	probably damaging	Het
Zdhhc4	C	T	5: 143,324,344		probably benign	Het

Other mutations in Rbm20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rbm20	APN	19	53843264	missense	probably damaging	1.00
IGL00815:Rbm20	APN	19	53815517	missense	probably damaging	1.00
IGL00845:Rbm20	APN	19	53817949	missense	probably damaging	1.00
IGL01408:Rbm20	APN	19	53851613	missense	possibly damaging	0.95
IGL01663:Rbm20	APN	19	53840995	missense	probably damaging	1.00
IGL01902:Rbm20	APN	19	53840991	missense	probably damaging	0.99
IGL01942:Rbm20	APN	19	53813443	missense	probably damaging	1.00
IGL02964:Rbm20	APN	19	53813702	missense	probably benign	0.02
IGL03326:Rbm20	APN	19	53814000	missense	possibly damaging	0.85
BB001:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB002:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
BB011:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
BB012:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R0326:Rbm20	UTSW	19	53864165	missense	probably damaging	1.00
R0487:Rbm20	UTSW	19	53851195	missense	probably damaging	1.00
R0965:Rbm20	UTSW	19	53859401	missense	probably damaging	1.00
R1435:Rbm20	UTSW	19	53814157	missense	probably benign	0.16
R1914:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R1915:Rbm20	UTSW	19	53864087	missense	probably damaging	1.00
R2011:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2012:Rbm20	UTSW	19	53859428	missense	probably damaging	1.00
R2258:Rbm20	UTSW	19	53851741	missense	probably benign
R3947:Rbm20	UTSW	19	53813337	missense	probably benign	0.35
R4308:Rbm20	UTSW	19	53843260	missense	probably damaging	1.00
R4521:Rbm20	UTSW	19	53817202	missense	probably benign	0.14
R4970:Rbm20	UTSW	19	53851669	missense	probably damaging	0.99
R5266:Rbm20	UTSW	19	53813387	missense	probably damaging	1.00
R5475:Rbm20	UTSW	19	53834705	nonsense	probably null
R5503:Rbm20	UTSW	19	53851354	missense	possibly damaging	0.75
R5995:Rbm20	UTSW	19	53851267	missense	possibly damaging	0.95
R6836:Rbm20	UTSW	19	53814069	missense	probably damaging	0.98
R6947:Rbm20	UTSW	19	53851265	missense	probably damaging	1.00
R7030:Rbm20	UTSW	19	53834766	missense	probably damaging	1.00
R7117:Rbm20	UTSW	19	53851558	missense	possibly damaging	0.92
R7237:Rbm20	UTSW	19	53851499	missense	probably benign	0.04
R7638:Rbm20	UTSW	19	53814333	missense	possibly damaging	0.95
R7792:Rbm20	UTSW	19	53850136	missense	probably benign
R7823:Rbm20	UTSW	19	53843354	missense	probably benign	0.33
R7924:Rbm20	UTSW	19	53677585	missense	possibly damaging	0.63
R7925:Rbm20	UTSW	19	53813322	missense	probably damaging	0.97
R8044:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8045:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8046:Rbm20	UTSW	19	53817971	missense	probably benign	0.44
R8100:Rbm20	UTSW	19	53851313	missense	possibly damaging	0.85
R8292:Rbm20	UTSW	19	53851499	missense	possibly damaging	0.71
R8366:Rbm20	UTSW	19	53850181	missense	possibly damaging	0.95
R8518:Rbm20	UTSW	19	53851492	missense	probably benign	0.18
R8799:Rbm20	UTSW	19	53832689	missense	probably damaging	1.00
R8873:Rbm20	UTSW	19	53677480	missense	probably benign	0.00
R8886:Rbm20	UTSW	19	53813336	missense	probably benign	0.00
R9194:Rbm20	UTSW	19	53834700	missense	probably damaging	1.00
R9226:Rbm20	UTSW	19	53851214	missense	possibly damaging	0.92
R9765:Rbm20	UTSW	19	53851629	missense	probably benign
R9793:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
R9795:Rbm20	UTSW	19	53864120	missense	probably benign	0.03
RF016:Rbm20	UTSW	19	53813732	missense	probably benign	0.00
Z1177:Rbm20	UTSW	19	53851685	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCTGCACTACTGGGTTGC -3'
(R):5'- TTCGAGTCGCTCATCCAAC -3'

Sequencing Primer
(F):5'- CACTACTGGGTTGCGACAAAAG -3'
(R):5'- TGTCCAGCTGCCTAGGATAG -3'

Posted On

2015-06-24