Incidental Mutation 'R4305:Gm7173'
ID 324014
Institutional Source Beutler Lab
Gene Symbol Gm7173
Ensembl Gene ENSMUSG00000073077
Gene Name predicted gene 7173
Synonyms
MMRRC Submission 041091-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R4305 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 79266559-79517285 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 79498029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 469 (K469N)
Ref Sequence ENSEMBL: ENSMUSP00000098956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101410] [ENSMUST00000197180]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000101410
AA Change: K469N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098956
Gene: ENSMUSG00000073077
AA Change: K469N

DomainStartEndE-ValueType
SCOP:d1grwa_ 390 460 1e-2 SMART
low complexity region 597 608 N/A INTRINSIC
low complexity region 653 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197180
AA Change: K469N

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142707
Gene: ENSMUSG00000073077
AA Change: K469N

DomainStartEndE-ValueType
low complexity region 597 608 N/A INTRINSIC
low complexity region 653 676 N/A INTRINSIC
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1599 1611 N/A INTRINSIC
CH 1679 1797 9e-6 SMART
low complexity region 2440 2451 N/A INTRINSIC
low complexity region 2578 2590 N/A INTRINSIC
low complexity region 2901 2911 N/A INTRINSIC
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 92% (36/39)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Abl2 T A 1: 156,641,563 M695K probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Atxn7l1 T C 12: 33,341,992 M93T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cd27 A G 6: 125,234,670 V98A probably benign Het
Chrdl2 A G 7: 100,022,022 T116A probably damaging Het
Epha6 T C 16: 60,526,520 probably null Het
Fam71f1 A G 6: 29,326,612 S243G probably damaging Het
Gart T C 16: 91,633,992 E394G possibly damaging Het
Gm5155 T A 7: 17,905,193 Y372N probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lpar6 G A 14: 73,238,941 R114Q probably damaging Het
Med23 G T 10: 24,904,270 E573* probably null Het
Mtch2 A G 2: 90,859,483 I183V probably benign Het
Nlrp3 C T 11: 59,548,010 R138* probably null Het
Notch1 T C 2: 26,477,924 D657G probably damaging Het
Olfr1281 A G 2: 111,329,298 D293G probably null Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Ttn T C 2: 76,918,337 S4123G probably benign Het
Ugt3a1 A C 15: 9,306,274 S170R possibly damaging Het
Vmn2r71 G T 7: 85,624,152 D725Y probably damaging Het
Vps9d1 G T 8: 123,248,237 probably benign Het
Yeats2 A G 16: 20,208,422 T808A probably damaging Het
Zdhhc4 C T 5: 143,324,344 probably benign Het
Other mutations in Gm7173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Gm7173 APN X 79489158 missense possibly damaging 0.87
IGL02025:Gm7173 APN X 79510430 missense probably benign 0.16
IGL02632:Gm7173 APN X 79496673 missense probably damaging 1.00
R1386:Gm7173 UTSW X 79509901 missense possibly damaging 0.54
R1551:Gm7173 UTSW X 79488645 missense probably damaging 1.00
R2121:Gm7173 UTSW X 79510321 missense probably benign 0.04
R2124:Gm7173 UTSW X 79510321 missense probably benign 0.04
R2192:Gm7173 UTSW X 79410612 missense probably damaging 1.00
R3725:Gm7173 UTSW X 79510015 missense probably damaging 0.97
R4304:Gm7173 UTSW X 79498029 missense probably damaging 1.00
R4522:Gm7173 UTSW X 79509995 missense possibly damaging 0.63
R4523:Gm7173 UTSW X 79509995 missense possibly damaging 0.63
Z1088:Gm7173 UTSW X 79330813 missense probably damaging 1.00
Z1088:Gm7173 UTSW X 79330814 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGGAAAAGCACTGTTTTGAACATG -3'
(R):5'- ATTGCTTATAAATCCCCGTGGTG -3'

Sequencing Primer
(F):5'- GAAAATCACATCACAGCTATGTAGG -3'
(R):5'- ATCCCCGTGGTGAAAATATGTTGC -3'
Posted On 2015-06-24