Mutagenetix > Incidental Mutations

Incidental Mutation 'R4306:Vmn2r12'

324025

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r12

Ensembl Gene

ENSMUSG00000090688

Gene Name

vomeronasal 2, receptor 12

Synonyms

Gm6769

MMRRC Submission

041092-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R4306 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109085849-109097864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109086006 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 780 (L780P)

Ref Sequence

ENSEMBL: ENSMUSP00000093612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095922]

Predicted Effect

probably damaging
Transcript: ENSMUST00000095922
AA Change: L780P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: L780P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	76	466	8.8e-30	PFAM
Pfam:NCD3G	505	559	1.7e-18	PFAM
Pfam:7tm_3	591	827	3.9e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

97% (33/34)

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,678,590	N27I	probably damaging	Het
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Chrdl2	A	G	7: 100,022,022	T116A	probably damaging	Het
Chst12	T	C	5: 140,524,646	F343L	probably damaging	Het
Cpeb2	T	A	5: 43,235,235		probably benign	Het
Cyp27b1	A	G	10: 127,051,088	D391G	probably benign	Het
Dll3	T	C	7: 28,301,657		probably null	Het
Dnah7b	T	A	1: 46,221,772	I2030N	probably damaging	Het
Fap	C	T	2: 62,530,707		probably null	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Fzd7	T	C	1: 59,484,407	V483A	probably damaging	Het
Gpm6a	T	C	8: 55,047,393		probably null	Het
Gprc6a	T	C	10: 51,616,639	H539R	probably damaging	Het
Irs1	C	T	1: 82,287,964	A844T	probably benign	Het
Myo1a	T	G	10: 127,714,081	S477A	probably benign	Het
Naga	C	T	15: 82,336,894	W67*	probably null	Het
Olfr615	A	T	7: 103,561,172	R232*	probably null	Het
Olfr615	G	C	7: 103,561,173	R232T	possibly damaging	Het
Osbpl1a	T	C	18: 12,819,595	E87G	probably benign	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Rb1	G	A	14: 73,262,695	T504I	probably damaging	Het
Rnf144b	A	G	13: 47,242,942	N252D	probably damaging	Het
Slit2	T	A	5: 48,302,783	N1385K	possibly damaging	Het
Tas2r124	A	G	6: 132,754,991	I88V	probably benign	Het
Trip11	A	G	12: 101,886,939	F465L	probably benign	Het
Usp31	G	A	7: 121,706,929	P109S	possibly damaging	Het
Vmn2r71	G	T	7: 85,624,152	D725Y	probably damaging	Het
Zfp459	T	C	13: 67,413,188	K47R	probably damaging	Het

Other mutations in Vmn2r12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00948:Vmn2r12	APN	5	109097675	missense	possibly damaging	0.47
IGL01096:Vmn2r12	APN	5	109086259	missense	probably damaging	1.00
IGL01538:Vmn2r12	APN	5	109091850	missense	probably damaging	1.00
IGL01548:Vmn2r12	APN	5	109093027	nonsense	probably null
IGL01762:Vmn2r12	APN	5	109086564	missense	probably damaging	0.99
IGL01860:Vmn2r12	APN	5	109092159	missense	probably benign	0.10
IGL02269:Vmn2r12	APN	5	109086477	missense	probably damaging	1.00
IGL02530:Vmn2r12	APN	5	109085992	missense	probably damaging	1.00
IGL02887:Vmn2r12	APN	5	109090485	missense	probably benign	0.03
IGL03265:Vmn2r12	APN	5	109092070	missense	probably benign	0.05
R0396:Vmn2r12	UTSW	5	109092899	missense	probably benign	0.00
R0497:Vmn2r12	UTSW	5	109091889	nonsense	probably null
R0529:Vmn2r12	UTSW	5	109092848	missense	probably benign
R0715:Vmn2r12	UTSW	5	109090507	missense	probably benign	0.10
R0742:Vmn2r12	UTSW	5	109086415	missense	possibly damaging	0.55
R0894:Vmn2r12	UTSW	5	109087850	critical splice donor site	probably null
R1173:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1174:Vmn2r12	UTSW	5	109092854	missense	probably benign	0.00
R1259:Vmn2r12	UTSW	5	109091897	missense	probably damaging	0.97
R1349:Vmn2r12	UTSW	5	109086586	missense	probably benign	0.00
R1388:Vmn2r12	UTSW	5	109092974	missense	possibly damaging	0.56
R1549:Vmn2r12	UTSW	5	109092830	missense	probably benign	0.06
R1766:Vmn2r12	UTSW	5	109092044	missense	probably damaging	1.00
R1781:Vmn2r12	UTSW	5	109091728	missense	probably benign	0.00
R1885:Vmn2r12	UTSW	5	109092076	missense	probably damaging	1.00
R2159:Vmn2r12	UTSW	5	109091474	missense	probably benign	0.02
R2420:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2421:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2422:Vmn2r12	UTSW	5	109086532	missense	probably benign	0.39
R2937:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R2938:Vmn2r12	UTSW	5	109091531	missense	probably damaging	1.00
R3898:Vmn2r12	UTSW	5	109090504	missense	probably benign	0.02
R4061:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4063:Vmn2r12	UTSW	5	109092192	missense	possibly damaging	0.95
R4090:Vmn2r12	UTSW	5	109091546	missense	probably benign	0.06
R4297:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4298:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4299:Vmn2r12	UTSW	5	109091964	missense	probably benign	0.12
R4304:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4307:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4308:Vmn2r12	UTSW	5	109086006	missense	probably damaging	1.00
R4594:Vmn2r12	UTSW	5	109086435	missense	probably damaging	1.00
R4783:Vmn2r12	UTSW	5	109086513	missense	probably damaging	1.00
R4900:Vmn2r12	UTSW	5	109092986	missense	probably damaging	1.00
R4929:Vmn2r12	UTSW	5	109091678	missense	probably damaging	1.00
R4974:Vmn2r12	UTSW	5	109091506	missense	probably damaging	1.00
R5389:Vmn2r12	UTSW	5	109090395	missense	probably benign	0.00
R5431:Vmn2r12	UTSW	5	109091818	missense	probably damaging	0.99
R5527:Vmn2r12	UTSW	5	109086617	nonsense	probably null
R5639:Vmn2r12	UTSW	5	109092800	missense	probably benign	0.06
R5753:Vmn2r12	UTSW	5	109091804	missense	probably damaging	1.00
R5797:Vmn2r12	UTSW	5	109085870	nonsense	probably null
R6142:Vmn2r12	UTSW	5	109092897	missense	probably benign
R6162:Vmn2r12	UTSW	5	109086564	missense	probably damaging	0.99
R6176:Vmn2r12	UTSW	5	109086000	missense	probably benign	0.43
R6853:Vmn2r12	UTSW	5	109092905	missense	probably damaging	1.00
R7238:Vmn2r12	UTSW	5	109097789	missense	possibly damaging	0.81
R7341:Vmn2r12	UTSW	5	109086247	missense	possibly damaging	0.74
R7341:Vmn2r12	UTSW	5	109091945	missense	possibly damaging	0.95
R7383:Vmn2r12	UTSW	5	109092818	missense	probably benign	0.19
R7740:Vmn2r12	UTSW	5	109091749	missense	probably damaging	1.00
R7749:Vmn2r12	UTSW	5	109086054	missense	probably damaging	0.99
R7861:Vmn2r12	UTSW	5	109087963	missense	probably benign	0.00
R7908:Vmn2r12	UTSW	5	109086441	missense	probably damaging	1.00
R8128:Vmn2r12	UTSW	5	109091881	missense	possibly damaging	0.81
R8175:Vmn2r12	UTSW	5	109090483	missense	probably damaging	0.97
R8234:Vmn2r12	UTSW	5	109086208	missense	probably benign	0.01
Z1088:Vmn2r12	UTSW	5	109092780	missense	probably benign
Z1176:Vmn2r12	UTSW	5	109091437	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCATGTTATCTTTGTACTTCTGCAG -3'
(R):5'- TTCAAGCTCACTACTCCTGGGAG -3'

Sequencing Primer
(F):5'- GTACTTCTGCAGATTTGAATCTAGTC -3'
(R):5'- CTCACTACTCCTGGGAGAAGGATG -3'

Posted On

2015-06-24