Incidental Mutation 'R4307:Vmn2r28'
ID324057
Institutional Source Beutler Lab
Gene Symbol Vmn2r28
Ensembl Gene ENSMUSG00000066820
Gene Namevomeronasal 2, receptor 28
SynonymsEG665255
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5479531-5493967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5490708 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 80 (F80I)
Ref Sequence ENSEMBL: ENSMUSP00000083477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086297]
Predicted Effect probably damaging
Transcript: ENSMUST00000086297
AA Change: F80I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: F80I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 470 1.7e-26 PFAM
Pfam:NCD3G 512 565 9.8e-21 PFAM
Pfam:7tm_3 598 833 2.8e-56 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Other mutations in Vmn2r28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Vmn2r28 APN 7 5488069 missense probably benign 0.12
IGL01061:Vmn2r28 APN 7 5488184 missense probably damaging 1.00
IGL01160:Vmn2r28 APN 7 5486478 missense probably damaging 0.99
IGL01335:Vmn2r28 APN 7 5481088 missense possibly damaging 0.67
IGL01532:Vmn2r28 APN 7 5486464 missense probably benign 0.16
IGL01791:Vmn2r28 APN 7 5488162 missense probably benign 0.00
IGL01875:Vmn2r28 APN 7 5481303 missense probably benign 0.30
IGL02161:Vmn2r28 APN 7 5488124 missense possibly damaging 0.88
IGL02499:Vmn2r28 APN 7 5490569 missense probably damaging 0.98
IGL02858:Vmn2r28 APN 7 5481004 missense probably damaging 0.99
IGL03061:Vmn2r28 APN 7 5484016 missense probably damaging 0.98
R0288:Vmn2r28 UTSW 7 5488021 missense probably damaging 1.00
R0361:Vmn2r28 UTSW 7 5493716 missense probably benign 0.00
R0396:Vmn2r28 UTSW 7 5488514 missense probably benign 0.05
R0480:Vmn2r28 UTSW 7 5490457 missense probably benign 0.00
R0485:Vmn2r28 UTSW 7 5488690 missense probably damaging 1.00
R0837:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R1282:Vmn2r28 UTSW 7 5481302 missense probably damaging 0.99
R1296:Vmn2r28 UTSW 7 5481545 missense possibly damaging 0.81
R1829:Vmn2r28 UTSW 7 5493811 missense probably benign
R1853:Vmn2r28 UTSW 7 5481247 nonsense probably null
R1869:Vmn2r28 UTSW 7 5486346 missense probably benign 0.00
R1887:Vmn2r28 UTSW 7 5488289 missense possibly damaging 0.90
R1961:Vmn2r28 UTSW 7 5481071 missense possibly damaging 0.85
R1998:Vmn2r28 UTSW 7 5488314 missense possibly damaging 0.87
R2392:Vmn2r28 UTSW 7 5484131 missense probably damaging 0.98
R2432:Vmn2r28 UTSW 7 5488702 missense probably damaging 0.99
R3055:Vmn2r28 UTSW 7 5481392 missense probably damaging 0.98
R3753:Vmn2r28 UTSW 7 5488027 missense probably damaging 0.99
R3877:Vmn2r28 UTSW 7 5488358 missense probably damaging 1.00
R5023:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5057:Vmn2r28 UTSW 7 5486464 missense probably benign 0.16
R5083:Vmn2r28 UTSW 7 5480672 missense possibly damaging 0.77
R5427:Vmn2r28 UTSW 7 5486377 missense probably damaging 0.99
R5472:Vmn2r28 UTSW 7 5487944 critical splice donor site probably null
R5511:Vmn2r28 UTSW 7 5484012 missense possibly damaging 0.61
R5731:Vmn2r28 UTSW 7 5488669 missense probably benign 0.41
R6091:Vmn2r28 UTSW 7 5493791 missense possibly damaging 0.88
R6179:Vmn2r28 UTSW 7 5488004 nonsense probably null
R6276:Vmn2r28 UTSW 7 5490731 missense probably benign 0.01
R6441:Vmn2r28 UTSW 7 5488475 missense probably benign 0.00
R6463:Vmn2r28 UTSW 7 5486436 missense probably benign 0.07
R6528:Vmn2r28 UTSW 7 5490685 missense probably benign 0.12
R6725:Vmn2r28 UTSW 7 5488409 missense probably benign 0.13
R6760:Vmn2r28 UTSW 7 5481230 missense probably damaging 0.97
R6849:Vmn2r28 UTSW 7 5480807 missense probably damaging 1.00
R7110:Vmn2r28 UTSW 7 5490734 missense probably benign 0.06
R7146:Vmn2r28 UTSW 7 5481496 missense probably benign 0.05
R7407:Vmn2r28 UTSW 7 5481309 missense probably damaging 1.00
R7563:Vmn2r28 UTSW 7 5488201 missense probably benign 0.00
R7611:Vmn2r28 UTSW 7 5481256 missense probably benign 0.02
R7808:Vmn2r28 UTSW 7 5493679 missense probably damaging 0.98
R7862:Vmn2r28 UTSW 7 5490614 missense probably benign 0.00
R7916:Vmn2r28 UTSW 7 5480819 missense probably damaging 1.00
R8183:Vmn2r28 UTSW 7 5488148 missense probably damaging 1.00
R8334:Vmn2r28 UTSW 7 5484060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTGTAAGCAGAAATGAACAC -3'
(R):5'- GTTCTCTGTGGATGAGGTCAATAC -3'

Sequencing Primer
(F):5'- GCAGAAATGAACACATAGTCTCTTC -3'
(R):5'- TGGGAGAAATACTGTCATGAAATTG -3'
Posted On2015-06-24