Mutagenetix > Incidental Mutation

Incidental Mutation 'R4307:Vmn2r28'

324057

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r28

Ensembl Gene

ENSMUSG00000066820

Gene Name

vomeronasal 2, receptor 28

Synonyms

EG665255

MMRRC Submission

041658-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R4307 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5479531-5493967 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5490708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 80 (F80I)

Ref Sequence

ENSEMBL: ENSMUSP00000083477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086297]

AlphaFold

L7N203

Predicted Effect

probably damaging
Transcript: ENSMUST00000086297
AA Change: F80I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000083477
Gene: ENSMUSG00000066820
AA Change: F80I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	470	1.7e-26	PFAM
Pfam:NCD3G	512	565	9.8e-21	PFAM
Pfam:7tm_3	598	833	2.8e-56	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (33/33)

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1500009L16Rik	A	C	10: 83,737,928	K22N	probably damaging	Het
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Asap2	T	C	12: 21,229,481	I426T	probably damaging	Het
Ccr5	T	C	9: 124,125,074	L238P	possibly damaging	Het
Cfap157	G	A	2: 32,779,042	R350W	probably damaging	Het
Efemp2	T	A	19: 5,481,621	Y430N	possibly damaging	Het
Egf	T	A	3: 129,719,095	Y473F	probably damaging	Het
Emilin3	T	C	2: 160,908,317	E504G	probably damaging	Het
Frmd4a	C	T	2: 4,333,078	R32C	probably benign	Het
Fuk	G	A	8: 110,892,080	Q349*	probably null	Het
Gm20939	A	T	17: 94,876,734	Y270F	possibly damaging	Het
Gpbp1	T	C	13: 111,448,983	*68W	probably null	Het
Gpm6a	T	C	8: 55,047,393		probably null	Het
Inpp5a	T	C	7: 139,574,963	S333P	possibly damaging	Het
Itgb5	T	G	16: 33,948,732	Y481D	possibly damaging	Het
Kif27	C	T	13: 58,344,123	V401I	probably benign	Het
Lca5l	C	T	16: 96,159,556		probably benign	Het
Mkl1	G	A	15: 81,016,347	L648F	possibly damaging	Het
Plxna4	A	G	6: 32,163,509	V1648A	probably damaging	Het
Polk	C	T	13: 96,496,666	E290K	possibly damaging	Het
Prr27	A	G	5: 87,842,907	H126R	probably benign	Het
Scn7a	A	T	2: 66,675,755	S1597T	possibly damaging	Het
Slc5a11	T	A	7: 123,269,870	H560Q	probably benign	Het
Top3b	T	C	16: 16,889,617		probably benign	Het
Unc13c	T	C	9: 73,693,367	N1365S	probably benign	Het
Vmn2r101	T	A	17: 19,590,161	V403E	probably damaging	Het
Vmn2r12	A	G	5: 109,086,006	L780P	probably damaging	Het

Other mutations in Vmn2r28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Vmn2r28	APN	7	5488069	missense	probably benign	0.12
IGL01061:Vmn2r28	APN	7	5488184	missense	probably damaging	1.00
IGL01160:Vmn2r28	APN	7	5486478	missense	probably damaging	0.99
IGL01335:Vmn2r28	APN	7	5481088	missense	possibly damaging	0.67
IGL01532:Vmn2r28	APN	7	5486464	missense	probably benign	0.16
IGL01791:Vmn2r28	APN	7	5488162	missense	probably benign	0.00
IGL01875:Vmn2r28	APN	7	5481303	missense	probably benign	0.30
IGL02161:Vmn2r28	APN	7	5488124	missense	possibly damaging	0.88
IGL02499:Vmn2r28	APN	7	5490569	missense	probably damaging	0.98
IGL02858:Vmn2r28	APN	7	5481004	missense	probably damaging	0.99
IGL03061:Vmn2r28	APN	7	5484016	missense	probably damaging	0.98
G1patch:Vmn2r28	UTSW	7	5488409	missense	probably benign	0.13
R0288:Vmn2r28	UTSW	7	5488021	missense	probably damaging	1.00
R0361:Vmn2r28	UTSW	7	5493716	missense	probably benign	0.00
R0396:Vmn2r28	UTSW	7	5488514	missense	probably benign	0.05
R0480:Vmn2r28	UTSW	7	5490457	missense	probably benign	0.00
R0485:Vmn2r28	UTSW	7	5488690	missense	probably damaging	1.00
R0837:Vmn2r28	UTSW	7	5488027	missense	probably damaging	0.99
R1282:Vmn2r28	UTSW	7	5481302	missense	probably damaging	0.99
R1296:Vmn2r28	UTSW	7	5481545	missense	possibly damaging	0.81
R1829:Vmn2r28	UTSW	7	5493811	missense	probably benign
R1853:Vmn2r28	UTSW	7	5481247	nonsense	probably null
R1869:Vmn2r28	UTSW	7	5486346	missense	probably benign	0.00
R1887:Vmn2r28	UTSW	7	5488289	missense	possibly damaging	0.90
R1961:Vmn2r28	UTSW	7	5481071	missense	possibly damaging	0.85
R1998:Vmn2r28	UTSW	7	5488314	missense	possibly damaging	0.87
R2392:Vmn2r28	UTSW	7	5484131	missense	probably damaging	0.98
R2432:Vmn2r28	UTSW	7	5488702	missense	probably damaging	0.99
R3055:Vmn2r28	UTSW	7	5481392	missense	probably damaging	0.98
R3753:Vmn2r28	UTSW	7	5488027	missense	probably damaging	0.99
R3877:Vmn2r28	UTSW	7	5488358	missense	probably damaging	1.00
R5023:Vmn2r28	UTSW	7	5486464	missense	probably benign	0.16
R5057:Vmn2r28	UTSW	7	5486464	missense	probably benign	0.16
R5083:Vmn2r28	UTSW	7	5480672	missense	possibly damaging	0.77
R5427:Vmn2r28	UTSW	7	5486377	missense	probably damaging	0.99
R5472:Vmn2r28	UTSW	7	5487944	critical splice donor site	probably null
R5511:Vmn2r28	UTSW	7	5484012	missense	possibly damaging	0.61
R5731:Vmn2r28	UTSW	7	5488669	missense	probably benign	0.41
R6091:Vmn2r28	UTSW	7	5493791	missense	possibly damaging	0.88
R6179:Vmn2r28	UTSW	7	5488004	nonsense	probably null
R6276:Vmn2r28	UTSW	7	5490731	missense	probably benign	0.01
R6441:Vmn2r28	UTSW	7	5488475	missense	probably benign	0.00
R6463:Vmn2r28	UTSW	7	5486436	missense	probably benign	0.07
R6528:Vmn2r28	UTSW	7	5490685	missense	probably benign	0.12
R6725:Vmn2r28	UTSW	7	5488409	missense	probably benign	0.13
R6760:Vmn2r28	UTSW	7	5481230	missense	probably damaging	0.97
R6849:Vmn2r28	UTSW	7	5480807	missense	probably damaging	1.00
R7110:Vmn2r28	UTSW	7	5490734	missense	probably benign	0.06
R7146:Vmn2r28	UTSW	7	5481496	missense	probably benign	0.05
R7407:Vmn2r28	UTSW	7	5481309	missense	probably damaging	1.00
R7563:Vmn2r28	UTSW	7	5488201	missense	probably benign	0.00
R7611:Vmn2r28	UTSW	7	5481256	missense	probably benign	0.02
R7808:Vmn2r28	UTSW	7	5493679	missense	probably damaging	0.98
R7862:Vmn2r28	UTSW	7	5490614	missense	probably benign	0.00
R7916:Vmn2r28	UTSW	7	5480819	missense	probably damaging	1.00
R8183:Vmn2r28	UTSW	7	5488148	missense	probably damaging	1.00
R8334:Vmn2r28	UTSW	7	5484060	missense	probably damaging	1.00
R8519:Vmn2r28	UTSW	7	5486348	missense	probably benign	0.31
R8989:Vmn2r28	UTSW	7	5490474	missense	probably benign	0.00
R9066:Vmn2r28	UTSW	7	5488597	missense	probably damaging	1.00
R9422:Vmn2r28	UTSW	7	5480748	missense	probably damaging	1.00
R9469:Vmn2r28	UTSW	7	5484119	missense	probably damaging	0.99
R9608:Vmn2r28	UTSW	7	5488221	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGTCCTGTAAGCAGAAATGAACAC -3'
(R):5'- GTTCTCTGTGGATGAGGTCAATAC -3'

Sequencing Primer
(F):5'- GCAGAAATGAACACATAGTCTCTTC -3'
(R):5'- TGGGAGAAATACTGTCATGAAATTG -3'

Posted On

2015-06-24