Incidental Mutation 'R4307:Inpp5a'
ID324060
Institutional Source Beutler Lab
Gene Symbol Inpp5a
Ensembl Gene ENSMUSG00000025477
Gene Nameinositol polyphosphate-5-phosphatase A
Synonyms
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location139389109-139579652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139574963 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 333 (S333P)
Ref Sequence ENSEMBL: ENSMUSP00000101704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026550] [ENSMUST00000097974] [ENSMUST00000097975] [ENSMUST00000106098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026550
AA Change: S333P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026550
Gene: ENSMUSG00000025477
AA Change: S333P

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
low complexity region 415 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097974
SMART Domains Protein: ENSMUSP00000095588
Gene: ENSMUSG00000041309

DomainStartEndE-ValueType
low complexity region 64 85 N/A INTRINSIC
HOX 148 210 8.32e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097975
AA Change: S341P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095589
Gene: ENSMUSG00000025477
AA Change: S341P

DomainStartEndE-ValueType
IPPc 25 408 1.84e-150 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106098
AA Change: S333P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101704
Gene: ENSMUSG00000025477
AA Change: S333P

DomainStartEndE-ValueType
IPPc 8 400 2.48e-165 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152475
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-associated type I inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a gene trapped allele show preweaning lethality, while surviving mice exhibit decreased body size, small cerebellum, and early-onset, slowly progressive Purkinje cell degeneration, gliosis, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in Inpp5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Inpp5a APN 7 139516721 missense probably benign 0.00
IGL01354:Inpp5a APN 7 139538234 missense probably damaging 0.99
IGL01734:Inpp5a APN 7 139454090 missense possibly damaging 0.92
IGL02536:Inpp5a APN 7 139567422 missense probably benign 0.17
IGL03023:Inpp5a APN 7 139525786 splice site probably null
IGL03390:Inpp5a APN 7 139525748 missense probably benign 0.01
Anza UTSW 7 139525738 missense probably damaging 1.00
borrego UTSW 7 139525670 missense probably damaging 1.00
Joshua_tree UTSW 7 139574982 missense probably damaging 1.00
PIT4402001:Inpp5a UTSW 7 139511453 missense probably benign 0.02
R0724:Inpp5a UTSW 7 139516663 missense probably benign 0.08
R0940:Inpp5a UTSW 7 139525738 missense probably damaging 1.00
R1258:Inpp5a UTSW 7 139525744 missense probably damaging 1.00
R2112:Inpp5a UTSW 7 139574961 missense probably damaging 0.99
R2328:Inpp5a UTSW 7 139478094 nonsense probably null
R4223:Inpp5a UTSW 7 139558905 missense possibly damaging 0.72
R4703:Inpp5a UTSW 7 139558923 missense probably damaging 1.00
R4781:Inpp5a UTSW 7 139478005 missense probably benign 0.11
R4997:Inpp5a UTSW 7 139400738 missense probably benign 0.07
R5762:Inpp5a UTSW 7 139538181 missense possibly damaging 0.95
R6014:Inpp5a UTSW 7 139574982 missense probably damaging 1.00
R6381:Inpp5a UTSW 7 139400673 missense probably benign 0.00
R7255:Inpp5a UTSW 7 139511448 missense probably damaging 0.96
R7324:Inpp5a UTSW 7 139525670 missense probably damaging 1.00
R7362:Inpp5a UTSW 7 139578380 missense probably benign 0.00
R7561:Inpp5a UTSW 7 139567422 missense probably damaging 0.99
R7748:Inpp5a UTSW 7 139574995 missense probably damaging 0.96
R8178:Inpp5a UTSW 7 139538237 missense probably damaging 1.00
R8253:Inpp5a UTSW 7 139481640 missense probably damaging 0.99
R8839:Inpp5a UTSW 7 139389433 missense probably benign 0.07
Z1177:Inpp5a UTSW 7 139525775 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTGACGCATGCAATAATAGG -3'
(R):5'- GAGGTGACTAAGCACTTCTCTC -3'

Sequencing Primer
(F):5'- CGCATGCAATAATAGGTACATGC -3'
(R):5'- GTGACTAAGCACTTCTCTCACTCATC -3'
Posted On2015-06-24