Incidental Mutation 'R4307:Gpbp1'
ID324071
Institutional Source Beutler Lab
Gene Symbol Gpbp1
Ensembl Gene ENSMUSG00000032745
Gene NameGC-rich promoter binding protein 1
Synonyms1700034P14Rik, D230035M11Rik
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location111425680-111490111 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 111448983 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 68 (*68W)
Ref Sequence ENSEMBL: ENSMUSP00000123249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047627] [ENSMUST00000091236] [ENSMUST00000136471] [ENSMUST00000231096]
Predicted Effect probably damaging
Transcript: ENSMUST00000047627
AA Change: E143G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048240
Gene: ENSMUSG00000032745
AA Change: E143G

DomainStartEndE-ValueType
low complexity region 232 243 N/A INTRINSIC
Pfam:Vasculin 395 491 1.9e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091236
AA Change: E143G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088777
Gene: ENSMUSG00000032745
AA Change: E143G

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
Pfam:Vasculin 374 471 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129638
Predicted Effect probably null
Transcript: ENSMUST00000136471
AA Change: *68W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156221
Predicted Effect probably damaging
Transcript: ENSMUST00000231096
AA Change: E143G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally isolated by subtractive hybridization of cDNAs expressed in atherosclerotic plaques with a thrombus, and was found to be expressed only in vascular smooth muscle cells. However, a shorter splice variant was found to be more ubiquitously expressed. This protein is suggested to play a role in the development of atherosclerosis. Studies in mice suggest that it may also function as a GC-rich promoter-specific trans-activating transcription factor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Efemp2 T A 19: 5,481,621 Y430N possibly damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in Gpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Gpbp1 APN 13 111440750 missense probably damaging 0.96
IGL01360:Gpbp1 APN 13 111426541 utr 3 prime probably benign
IGL01609:Gpbp1 APN 13 111439202 missense possibly damaging 0.62
IGL01747:Gpbp1 APN 13 111453050 missense probably damaging 0.99
IGL02614:Gpbp1 APN 13 111436473 missense probably benign 0.01
IGL03329:Gpbp1 APN 13 111453253 splice site probably benign
R0315:Gpbp1 UTSW 13 111436538 missense possibly damaging 0.50
R0510:Gpbp1 UTSW 13 111440745 missense possibly damaging 0.58
R1549:Gpbp1 UTSW 13 111436579 missense probably benign 0.00
R1582:Gpbp1 UTSW 13 111436532 splice site probably null
R1762:Gpbp1 UTSW 13 111440774 missense probably benign 0.02
R2074:Gpbp1 UTSW 13 111453407 missense probably benign 0.18
R2276:Gpbp1 UTSW 13 111466978 splice site probably null
R3685:Gpbp1 UTSW 13 111466871 missense probably benign 0.06
R4408:Gpbp1 UTSW 13 111448964 missense possibly damaging 0.63
R4840:Gpbp1 UTSW 13 111440630 critical splice donor site probably null
R4952:Gpbp1 UTSW 13 111440750 missense probably damaging 0.96
R5152:Gpbp1 UTSW 13 111453281 intron probably benign
R5376:Gpbp1 UTSW 13 111426642 missense probably damaging 1.00
R6143:Gpbp1 UTSW 13 111466855 missense probably damaging 0.98
R6378:Gpbp1 UTSW 13 111433612 missense probably damaging 1.00
R6516:Gpbp1 UTSW 13 111453102 missense probably benign 0.05
R6687:Gpbp1 UTSW 13 111438085 missense possibly damaging 0.78
R6745:Gpbp1 UTSW 13 111453385 missense probably benign 0.05
R7186:Gpbp1 UTSW 13 111440699 missense possibly damaging 0.89
R7310:Gpbp1 UTSW 13 111453390 missense probably benign 0.02
R7669:Gpbp1 UTSW 13 111439124 missense probably benign 0.16
R7881:Gpbp1 UTSW 13 111439199 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- GGTATCTAAGCACATCAAATGCAG -3'
(R):5'- TATCTCTCAGGCAGTAAGATGAAG -3'

Sequencing Primer
(F):5'- ATGCAGCTACTAAAGAGTTTTACTG -3'
(R):5'- GTCTCCAACTAGCAATGGTTAGC -3'
Posted On2015-06-24