Incidental Mutation 'R4307:Efemp2'
ID324078
Institutional Source Beutler Lab
Gene Symbol Efemp2
Ensembl Gene ENSMUSG00000024909
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 2
SynonymsMBP1, fibulin-4, Fbln4, 0610011K11Rik, fibulin 4
MMRRC Submission 041658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4307 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5473973-5481853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5481621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 430 (Y430N)
Ref Sequence ENSEMBL: ENSMUSP00000064719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000070118] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000165485] [ENSMUST00000166253] [ENSMUST00000167304] [ENSMUST00000167371] [ENSMUST00000167827] [ENSMUST00000167855] [ENSMUST00000168330] [ENSMUST00000169943]
Predicted Effect probably benign
Transcript: ENSMUST00000025841
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070118
AA Change: Y430N

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064719
Gene: ENSMUSG00000024909
AA Change: Y430N

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
EGF_like 73 113 2.74e-1 SMART
low complexity region 115 130 N/A INTRINSIC
EGF_CA 142 182 1.08e-10 SMART
EGF_CA 183 221 1.94e-12 SMART
EGF_CA 222 261 1.36e-7 SMART
EGF_CA 262 301 2.19e-11 SMART
EGF 305 347 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124334
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126471
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133436
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154215
Predicted Effect probably benign
Transcript: ENSMUST00000164204
SMART Domains Protein: ENSMUSP00000128414
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Pfam:EGF_CA 37 69 5.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164388
SMART Domains Protein: ENSMUSP00000131979
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
EGF 4 35 1.59e1 SMART
EGF 39 81 1.95e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165485
AA Change: Y411N

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133016
Gene: ENSMUSG00000024909
AA Change: Y411N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 163 1.08e-10 SMART
EGF_CA 164 202 1.94e-12 SMART
EGF_CA 203 242 1.36e-7 SMART
EGF_CA 243 282 2.19e-11 SMART
EGF 286 328 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166253
SMART Domains Protein: ENSMUSP00000127312
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 54 92 1.94e-12 SMART
EGF_CA 93 132 1.36e-7 SMART
EGF_CA 133 172 2.19e-11 SMART
EGF 176 218 1.95e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166558
Predicted Effect probably benign
Transcript: ENSMUST00000167304
SMART Domains Protein: ENSMUSP00000129982
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:EGF_CA 54 86 2.4e-9 PFAM
low complexity region 96 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167371
AA Change: Y370N

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129746
Gene: ENSMUSG00000024909
AA Change: Y370N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_like 54 94 2.74e-1 SMART
low complexity region 96 111 N/A INTRINSIC
EGF_CA 123 161 1.94e-12 SMART
EGF_CA 162 201 1.36e-7 SMART
EGF_CA 202 241 2.19e-11 SMART
EGF 245 287 1.95e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167827
SMART Domains Protein: ENSMUSP00000127478
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 9e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
EGF_CA 135 174 1.36e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167855
SMART Domains Protein: ENSMUSP00000132194
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
Blast:EGF_like 1 26 4e-10 BLAST
low complexity region 28 43 N/A INTRINSIC
EGF_CA 55 95 1.08e-10 SMART
EGF_CA 96 134 1.94e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168330
Predicted Effect probably benign
Transcript: ENSMUST00000169943
SMART Domains Protein: ENSMUSP00000126477
Gene: ENSMUSG00000024909

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Meta Mutation Damage Score 0.5094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large number of extracellular matrix proteins have been found to contain variations of the epidermal growth factor (EGF) domain and have been implicated in functions as diverse as blood coagulation, activation of complement and determination of cell fate during development. The protein encoded by this gene contains four EGF2 domains and six calcium-binding EGF2 domains. This gene is necessary for elastic fiber formation and connective tissue development. Defects in this gene are cause of an autosomal recessive cutis laxa syndrome. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality with abnormal artery and lung morphology and defects in vascular, pulmonary, and hypodermal elastic fibers. Some alleles of Mus81 also affect expression of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik A C 10: 83,737,928 K22N probably damaging Het
A830018L16Rik C A 1: 11,972,076 S440* probably null Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ccr5 T C 9: 124,125,074 L238P possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Egf T A 3: 129,719,095 Y473F probably damaging Het
Emilin3 T C 2: 160,908,317 E504G probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Fuk G A 8: 110,892,080 Q349* probably null Het
Gm20939 A T 17: 94,876,734 Y270F possibly damaging Het
Gpbp1 T C 13: 111,448,983 *68W probably null Het
Gpm6a T C 8: 55,047,393 probably null Het
Inpp5a T C 7: 139,574,963 S333P possibly damaging Het
Itgb5 T G 16: 33,948,732 Y481D possibly damaging Het
Kif27 C T 13: 58,344,123 V401I probably benign Het
Lca5l C T 16: 96,159,556 probably benign Het
Mkl1 G A 15: 81,016,347 L648F possibly damaging Het
Plxna4 A G 6: 32,163,509 V1648A probably damaging Het
Polk C T 13: 96,496,666 E290K possibly damaging Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Scn7a A T 2: 66,675,755 S1597T possibly damaging Het
Slc5a11 T A 7: 123,269,870 H560Q probably benign Het
Top3b T C 16: 16,889,617 probably benign Het
Unc13c T C 9: 73,693,367 N1365S probably benign Het
Vmn2r101 T A 17: 19,590,161 V403E probably damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r28 A T 7: 5,490,708 F80I probably damaging Het
Other mutations in Efemp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03011:Efemp2 APN 19 5480065 missense probably damaging 0.99
IGL03079:Efemp2 APN 19 5475127 missense probably damaging 1.00
H8562:Efemp2 UTSW 19 5480649 missense probably benign 0.43
R0149:Efemp2 UTSW 19 5477960 missense probably damaging 1.00
R0266:Efemp2 UTSW 19 5477999 missense probably damaging 1.00
R0594:Efemp2 UTSW 19 5475063 unclassified probably benign
R0723:Efemp2 UTSW 19 5480050 missense probably damaging 1.00
R2110:Efemp2 UTSW 19 5475162 missense probably damaging 1.00
R4494:Efemp2 UTSW 19 5480311 missense probably damaging 1.00
R4878:Efemp2 UTSW 19 5480761 unclassified probably benign
R4889:Efemp2 UTSW 19 5475120 missense probably null 1.00
R5156:Efemp2 UTSW 19 5477678 missense possibly damaging 0.93
R5165:Efemp2 UTSW 19 5475411 missense probably damaging 1.00
R6932:Efemp2 UTSW 19 5480245 missense probably damaging 1.00
R7171:Efemp2 UTSW 19 5480257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTACAGGTTAGAGCCAGGG -3'
(R):5'- TTTAAGCAGAACGGTCATCCCTAG -3'

Sequencing Primer
(F):5'- ACTTGAGCAGGGGCCTTGTC -3'
(R):5'- GGTCATCCCTAGGCCCC -3'
Posted On2015-06-24