Incidental Mutation 'R4308:Olfr1148'
ID324086
Institutional Source Beutler Lab
Gene Symbol Olfr1148
Ensembl Gene ENSMUSG00000061875
Gene Nameolfactory receptor 1148
SynonymsGA_x6K02T2Q125-49334566-49335510, MOR264-7
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87830533-87835803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87833270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 77 (I77T)
Ref Sequence ENSEMBL: ENSMUSP00000149438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077580] [ENSMUST00000215230]
Predicted Effect probably damaging
Transcript: ENSMUST00000077580
AA Change: I77T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076778
Gene: ENSMUSG00000061875
AA Change: I77T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.1e-54 PFAM
Pfam:7tm_1 47 296 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215230
AA Change: I77T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Olfr1148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Olfr1148 APN 2 87833500 missense probably damaging 1.00
IGL01893:Olfr1148 APN 2 87833863 nonsense probably null
IGL02247:Olfr1148 APN 2 87833529 missense probably damaging 0.97
IGL02286:Olfr1148 APN 2 87833248 missense probably damaging 0.99
IGL02645:Olfr1148 APN 2 87833615 missense probably benign 0.21
R1304:Olfr1148 UTSW 2 87833705 missense possibly damaging 0.51
R1762:Olfr1148 UTSW 2 87833665 missense probably damaging 0.98
R1770:Olfr1148 UTSW 2 87833299 missense probably benign 0.05
R4721:Olfr1148 UTSW 2 87833171 missense probably damaging 1.00
R6011:Olfr1148 UTSW 2 87833915 missense probably damaging 1.00
R6225:Olfr1148 UTSW 2 87833317 missense probably benign 0.04
R6243:Olfr1148 UTSW 2 87833041 start codon destroyed probably null 0.00
R6367:Olfr1148 UTSW 2 87833593 missense probably damaging 1.00
R7379:Olfr1148 UTSW 2 87833779 missense probably damaging 1.00
R7510:Olfr1148 UTSW 2 87833528 missense probably damaging 0.97
R8003:Olfr1148 UTSW 2 87833737 missense probably benign 0.00
X0050:Olfr1148 UTSW 2 87833534 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATGAATCATGAAGAGCTAGAGTCC -3'
(R):5'- TTGCATATGGCCACATATCGG -3'

Sequencing Primer
(F):5'- CCACAGTGATACAGTTTGTGC -3'
(R):5'- CATATGGCCACATATCGGTCATAGG -3'
Posted On2015-06-24