Incidental Mutation 'R4308:Fktn'
ID324088
Institutional Source Beutler Lab
Gene Symbol Fktn
Ensembl Gene ENSMUSG00000028414
Gene Namefukutin
SynonymsFukutin, Fcmd
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53713998-53777890 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 53724617 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061771] [ENSMUST00000107638] [ENSMUST00000128667] [ENSMUST00000221657] [ENSMUST00000222290]
Predicted Effect probably benign
Transcript: ENSMUST00000061771
SMART Domains Protein: ENSMUSP00000061489
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107638
AA Change: H40Y
SMART Domains Protein: ENSMUSP00000138774
Gene: ENSMUSG00000028414
AA Change: H40Y

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128667
SMART Domains Protein: ENSMUSP00000114699
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158996
Predicted Effect probably benign
Transcript: ENSMUST00000221657
Predicted Effect unknown
Transcript: ENSMUST00000222290
AA Change: H40Y
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice die by E9.5. Embryos exhibit diverse phenotypes such as growth retardation, folding of the egg cylinder, leakage of maternal red blood cells into the yolk sac cavity, increased number of apoptotic cells in the ectoderm, and thin and breached basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Prr27 A G 5: 87,842,907 H126R probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Fktn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fktn APN 4 53734866 missense probably benign 0.17
IGL00562:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00563:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00972:Fktn APN 4 53734992 missense probably damaging 1.00
IGL01025:Fktn APN 4 53737568 missense possibly damaging 0.51
IGL02329:Fktn APN 4 53720181 missense probably benign 0.40
IGL03149:Fktn APN 4 53744653 missense probably benign
IGL03310:Fktn APN 4 53720120 nonsense probably null
beijing UTSW 4 53734880 missense probably damaging 1.00
R0257:Fktn UTSW 4 53734898 missense probably benign 0.09
R0311:Fktn UTSW 4 53744620 missense probably benign 0.10
R1368:Fktn UTSW 4 53734880 missense probably damaging 1.00
R1500:Fktn UTSW 4 53735065 missense probably benign
R1654:Fktn UTSW 4 53761220 missense probably benign 0.01
R1757:Fktn UTSW 4 53747003 splice site probably benign
R2007:Fktn UTSW 4 53735099 missense possibly damaging 0.56
R4374:Fktn UTSW 4 53720201 missense probably damaging 0.99
R4798:Fktn UTSW 4 53744637 missense probably benign 0.01
R5563:Fktn UTSW 4 53761327 missense probably damaging 1.00
R5913:Fktn UTSW 4 53735035 nonsense probably null
R5997:Fktn UTSW 4 53735061 missense probably benign 0.00
R6227:Fktn UTSW 4 53731136 missense probably benign
R6942:Fktn UTSW 4 53735128 critical splice donor site probably null
R7832:Fktn UTSW 4 53734859 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATTCTTCTATCCCCTAGTGTTTAG -3'
(R):5'- TGGTACCCAGTGGCTACAAC -3'

Sequencing Primer
(F):5'- CCCCTAGTGTTTAGACTTTGTAATTC -3'
(R):5'- GTACCCAGTGGCTACAACTGTAAATG -3'
Posted On2015-06-24