Incidental Mutation 'R4308:Prr27'
ID324092
Institutional Source Beutler Lab
Gene Symbol Prr27
Ensembl Gene ENSMUSG00000002240
Gene Nameproline rich 27
Synonyms4930432K09Rik
MMRRC Submission 041659-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4308 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87825686-87846387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87842907 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 126 (H126R)
Ref Sequence ENSEMBL: ENSMUSP00000098617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002310] [ENSMUST00000101056]
Predicted Effect probably benign
Transcript: ENSMUST00000002310
AA Change: H118R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002310
Gene: ENSMUSG00000002240
AA Change: H118R

DomainStartEndE-ValueType
low complexity region 49 57 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
low complexity region 137 153 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101056
AA Change: H126R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098617
Gene: ENSMUSG00000002240
AA Change: H126R

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 112 138 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197636
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,440,192 T4425M probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Asap2 T C 12: 21,229,481 I426T probably damaging Het
Ascc1 T G 10: 60,013,612 H108Q probably benign Het
Bod1l A T 5: 41,791,813 S2989T possibly damaging Het
Cfap157 G A 2: 32,779,042 R350W probably damaging Het
Cyp39a1 T A 17: 43,730,964 probably null Het
Dars2 A G 1: 161,041,721 S653P probably damaging Het
Fam208b A C 13: 3,569,498 S2244R probably damaging Het
Fancm A T 12: 65,126,531 K1872N probably benign Het
Fktn C T 4: 53,724,617 probably benign Het
Gpr33 A T 12: 52,023,640 C205* probably null Het
Gsdmc2 A G 15: 63,848,705 probably benign Het
Il31 A G 5: 123,480,706 S6P probably damaging Het
Iqca T C 1: 90,144,897 K87R probably damaging Het
Kif15 T G 9: 123,013,982 H47Q probably benign Het
L3mbtl3 C T 10: 26,282,792 A653T unknown Het
Lamb1 T C 12: 31,329,255 L1737P probably damaging Het
Map2k5 C G 9: 63,235,304 R353S probably benign Het
Mical2 C A 7: 112,331,992 L721I probably benign Het
Myo1b T C 1: 51,883,109 K37E probably benign Het
Myo5b A G 18: 74,731,740 D1369G possibly damaging Het
Npc1 C T 18: 12,210,527 A470T possibly damaging Het
Olfr1148 T C 2: 87,833,270 I77T probably damaging Het
Olfr116 C T 17: 37,623,736 V300I possibly damaging Het
Pcdhb1 A T 18: 37,266,661 D555V probably benign Het
Rbm20 A G 19: 53,843,260 S642G probably damaging Het
Rnf144b A G 13: 47,242,942 N252D probably damaging Het
Rnf219 T A 14: 104,479,593 N448I probably damaging Het
Rwdd2b A T 16: 87,436,727 W162R probably damaging Het
Scaf11 A G 15: 96,446,515 M19T probably benign Het
Sft2d2 A G 1: 165,188,264 I45T probably benign Het
Skint5 A T 4: 113,483,967 H1371Q unknown Het
Tas2r124 A G 6: 132,754,991 I88V probably benign Het
Ubr4 T C 4: 139,472,509 V4568A possibly damaging Het
Vmn2r12 A G 5: 109,086,006 L780P probably damaging Het
Vmn2r18 A T 5: 151,584,803 Y285* probably null Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp983 A G 17: 21,662,208 I351V probably benign Het
Other mutations in Prr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Prr27 APN 5 87843443 missense possibly damaging 0.90
IGL02617:Prr27 APN 5 87842659 missense probably benign 0.00
IGL02995:Prr27 APN 5 87842816 missense probably benign
IGL03270:Prr27 APN 5 87835678 utr 5 prime probably benign
R0531:Prr27 UTSW 5 87842678 missense probably benign 0.02
R0637:Prr27 UTSW 5 87851146 unclassified probably benign
R1498:Prr27 UTSW 5 87850741 unclassified probably benign
R1599:Prr27 UTSW 5 87843225 missense probably benign 0.00
R1744:Prr27 UTSW 5 87843047 missense possibly damaging 0.46
R1980:Prr27 UTSW 5 87843402 missense probably benign 0.03
R4033:Prr27 UTSW 5 87843305 nonsense probably null
R4304:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4306:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4307:Prr27 UTSW 5 87842907 missense probably benign 0.00
R4347:Prr27 UTSW 5 87842672 missense possibly damaging 0.46
R4675:Prr27 UTSW 5 87843241 missense possibly damaging 0.94
R4826:Prr27 UTSW 5 87850966 unclassified probably benign
R4908:Prr27 UTSW 5 87843029 missense probably benign 0.01
R5361:Prr27 UTSW 5 87843344 missense probably damaging 0.96
R5426:Prr27 UTSW 5 87850885 unclassified probably benign
R7268:Prr27 UTSW 5 87843276 missense probably damaging 0.99
R7785:Prr27 UTSW 5 87843272 missense probably benign
Z1088:Prr27 UTSW 5 87842646 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCTATGGAATGATAATTTGCC -3'
(R):5'- TCCAAGTTTGACTGCCTGAGG -3'

Sequencing Primer
(F):5'- TGCCTCCTTTTAACACTCAACAAGG -3'
(R):5'- CTCAGGTCTAACAGGTGA -3'
Posted On2015-06-24